Huh?

Here's what the dull of mind and slow of thought say after a week and a half spent talking about information, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”

I say, “I’m defining information between Ginx and I as, “The communication or reception of knowledge or intelligence.” And I`m defining information found in biological organisms as , “the attribute inherent in, and communicated by alternative sequences or arrangements of something that produces specific effects.” Both definitions are from Webster’s English Dictionary.

Atheists say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”

I say, “Information as it is defined in the second definition does not require a conscious recipient of a message; because it is referring to a sequence of characters that produces a specific effect.

Information as it is defined in the first definition means that the only thing preceding our information exchanges were our thoughts which in turn found their origin in our intelligence, our intellect, our mind.

Atheists say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”

I say:
01010111011010000011001011011100010000001101001011
01110001000000111010001101000011001010010000001000
00110110111011101010111001000111001101100101001000
00011011110110011000100000011010000111010101101101
011000010110111000100000011001010111011001100101
011011100111010001110011001000000110100101110100

Know what that says in the American Standard Code for Information Interchange, i.e., Binary Code?

ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGG
CCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCC
GCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCG
CCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAG
GCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC

How about this code? Do you think it took intelligent thought to construct this information in a manner that would allow for life to begin to exist? This is part of the sequence of genetic assembly instructions for constructing an RNA polymerase. This “machine code” is critical for information processing in a living cell. Without it being exactly as is - no working cell.
Watson and Crick, “Molecular Biology of the Gene,” 1:704

Humans of course are used to information.
We create information via our thoughts.
We pass on that information to others, and
We take in information that was created by other people’s thoughts.
We do this all day long.

“The technology of information theory and coding theory has been in place in biology for at least 3.85 billion years.”
“River out of Eden”, 17

As even Richard Dawkins says, “The machine code of the genes is uncannily computer-like.

“DNA is like a computer program but far, far more advanced than any software ever created.”

All of human experience confirms that information comes from thoughts and thoughts come from intelligence.

I show atheists that DNA forms part of a communication channel that can be analysed using information theory.

I show atheists that DNA molecules are highly and quantifiably complex.

I show atheists that the arrangement of bases in DNA and amino acids in proteins carry not just complexity but SPECIFIED complexity.

I show atheists that the information in DNA contains alternative sequences or arrangements that produce a specific effect.

I show atheists that DNA displays a functional specificity that goes WAY beyond the mathematical formalism of information theory.

Whether atheists know it or not (not) this specified complexity is found no where else in nature. Only in DNA, RNA and proteins do we find this information in a specified complex formulation.

Information scientist Hubert Yockey, “The genetic code is constructed to confront and solve the problems of communication and recording by the same principles found in modern communication and computer codes.”

DNA is amazingly complex information. But information is useless if there is no way to retrieve, process, translate and use that information for the PURPOSE intended.

Information is an entity in and of itself? Information is not a by-product, or some sort of residue from chemical reactions.

Information is as real as matter and energy. We own it, buy it, sell it, store it, transmit it, encode it and decode it.

Information comes from a thought that is based in an intelligent mind. The intelligent mind forms / invents a code, be it binary code, or letters in an alphabet, or base chemicals, A,C,G,T and the intelligent mind uses that code to convey the message / instructions to the intended recipient.

This - I love you. I'll meet you after work. - is specified complexity.

Not only does it use parts of a very complex code. It uses the complex code in a formulated and specified manner to convey a message or instructions.

Our cells don’t just contain a place to store vast amounts of information. They contain a code, a specified code (information) for translating that code AND they contain a means, a processing system which allows the construction of proteins.

The main question facing scientists today when trying to explain the origin of first life is: “How did the sequence-specific digital information necessary to building the first cell arise?”
Kuppers, “Information and the Origin of Life,” 170-172.

The reduction of uncertainty takes place with the transmission of information. The more improbable the event the more information that is conveyed.

If forces of potential energy determined the arrangement of the bases, the code-like character of the molecule would be effaced by an overwhelming redundancy.”

The effects of chemical necessity would do nothing but REDUCE the ability to transmit information or express novelty.

No information is generated by the occurrence of events for which there are no possible alternatives.

To the degree that chemical predestination exists, to that degree is the information carrying ability of the system reduced by redundancy. In fact it is for no other reason that DNA is NOT chemically predestined. It is only because it is NOT chemically predestined that the DNA molecule is able to store and transmit huge, huge unimaginably huge amounts of information.

It is this physical indeterminacy of the sequence that produces the improbability of occurrence of any particular sequence and thereby enable it to have a meaning - a meaning that has a mathematically determinate information content equal to the numerical improbability of the arrangement.

I ’m defining information between Ginx and I as, “The communication or reception of knowledge or intelligence.” And I`m defining information found in biological organisms as , “the attribute inherent in, and communicated by alternative sequences or arrangements of something that produces specific effects.” Both definitions are from Webster’s English Dictionary.

Information as it is defined in the second definition does not require a conscious recipient of a message; because it is referring to a sequence of characters that produces a specific effect.

Information as it is defined in the first definition means that the only thing preceding our information exchanges were our thoughts which in turn found their origin in our intelligence, our intellect, our mind.

The dull of mind and slow of thought say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”