"Es - ka - Pay"

I began this series with two posts:

“Nothing Did It” http://makarios-makarios.blogspot.com/2009/12/nothing-did-it.html

“Atheism of the Gaps” - http://makarios-makarios.blogspot.com/2009/12/atheism-of-gaps.html
=========================
Remember in the movie Nemo when Dora and Nemo are trapped in a ship and they have to get out as soon as possible? And Dora sees a sign that says “Escape Hatch” and Dora looks at the sign and says Es - ka - Pay?

That’s how I feel when talking to atheists.

I show atheists the genetic code for life itself. And the atheist says, Es - ka - Pay.

ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGG
CCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCC
GCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCG
CCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAG
GCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC

I show atheists that DNA can encode information using chemical subunits that function like an alphabet, and the atheist says, Es - ka - Pay.

I show atheists that DNA forms part of a communication channel that can be analysed using information theory, and the atheist says, Es - ka - Pay.

I show atheists that DNA molecules are highly and quantifiably complex, and the atheist says, Es - ka - Pay.

I show atheists that the arrangement of bases in DNA and amino acids in proteins carry not just complexity but SPECIFIED complexity, and the atheist says, Es - ka - Pay.

I show atheists that the information in DNA contains alternative sequences or arrangements that produce a specific effect, and the atheist says, Es - ka - Pay.

I show atheists that DNA displays a functional specificity that goes WAY beyond the mathematical formalism of information theory, and the atheist says, Es - ka - Pay.

Whether atheists know it or not (not) this specified complexity is found no where else in nature. Only in DNA, RNA and proteins do we find this information in a specified complex formulation. And the atheist says, Es - ka - Pay.

Information scientist Hubert Yockey, “The genetic code is constructed to confront and solve the problems of communication and recording by the same principles found in modern communication and computer codes.”

Do most atheists sense how improbable it is that digitally encoded and specifically sequenced instructions in DNA arose unaided out of inorganic gases?

Do most atheists understand that encoded information is worthless without a system that can process the information?

Do most atheists understand that the cell’s information-processing system had to evolve separately from the DNA information system?

Do you understand what’s just been said?

I’m afraid that most atheists reading this, completely unencumbered by understanding simply say, Es - ka - Pay.

Atheists say the most complex information system ever, evolved 3.8 billion years ago from a blind, unguided, purposeless process.


DNA is amazingly complex information. But information is useless if there is no way to retrieve, process, translate and use that information for the PURPOSE intended.


Atheists say that A COMPLETELY INDEPENDENT information processing system evolved from the same blind, unguided, purposeless system.

Just as there is no reason whatsoever for our life-sustaining universe to exist:
. There is no reason whatsoever that either of these information and information processing systems should have evolved at all.

. There is no reason whatsoever that one system should have produced not just information, but specified information that could be read by an independent processing system.

. There is no reason whatsoever that the processing system should have been able to read, translate and use the information that evolved separately in a different system.

. There is no reason whatsoever that these two systems should come together in the same molecule by the same blind, unguided, purposeless system.

Do atheists comprehend what it is they place their faith in? Certainly not the atheists posting here. You know what their answer is to these issues? Of course you do.

“Well Mak, it took millions of years!”

Es - ka - Pay