Monday, December 7, 2009

"Es - ka - Pay"

I began this series with two posts:

“Nothing Did It” http://makarios-makarios.blogspot.com/2009/12/nothing-did-it.html

“Atheism of the Gaps” - http://makarios-makarios.blogspot.com/2009/12/atheism-of-gaps.html
=========================
Remember in the movie Nemo when Dora and Nemo are trapped in a ship and they have to get out as soon as possible? And Dora sees a sign that says “Escape Hatch” and Dora looks at the sign and says Es - ka - Pay?

That’s how I feel when talking to atheists.

I show atheists the genetic code for life itself. And the atheist says, Es - ka - Pay.

ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGG
CCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCC
GCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCG
CCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAG
GCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC

I show atheists that DNA can encode information using chemical subunits that function like an alphabet, and the atheist says, Es - ka - Pay.

I show atheists that DNA forms part of a communication channel that can be analysed using information theory, and the atheist says, Es - ka - Pay.

I show atheists that DNA molecules are highly and quantifiably complex, and the atheist says, Es - ka - Pay.

I show atheists that the arrangement of bases in DNA and amino acids in proteins carry not just complexity but SPECIFIED complexity, and the atheist says, Es - ka - Pay.

I show atheists that the information in DNA contains alternative sequences or arrangements that produce a specific effect, and the atheist says, Es - ka - Pay.

I show atheists that DNA displays a functional specificity that goes WAY beyond the mathematical formalism of information theory, and the atheist says, Es - ka - Pay.

Whether atheists know it or not (not) this specified complexity is found no where else in nature. Only in DNA, RNA and proteins do we find this information in a specified complex formulation. And the atheist says, Es - ka - Pay.

Information scientist Hubert Yockey, “The genetic code is constructed to confront and solve the problems of communication and recording by the same principles found in modern communication and computer codes.”

Do most atheists sense how improbable it is that digitally encoded and specifically sequenced instructions in DNA arose unaided out of inorganic gases?

Do most atheists understand that encoded information is worthless without a system that can process the information?

Do most atheists understand that the cell’s information-processing system had to evolve separately from the DNA information system?

Do you understand what’s just been said?

I’m afraid that most atheists reading this, completely unencumbered by understanding simply say, Es - ka - Pay.

Atheists say the most complex information system ever, evolved 3.8 billion years ago from a blind, unguided, purposeless process.


DNA is amazingly complex information. But information is useless if there is no way to retrieve, process, translate and use that information for the PURPOSE intended.


Atheists say that A COMPLETELY INDEPENDENT information processing system evolved from the same blind, unguided, purposeless system.

Just as there is no reason whatsoever for our life-sustaining universe to exist:
. There is no reason whatsoever that either of these information and information processing systems should have evolved at all.

. There is no reason whatsoever that one system should have produced not just information, but specified information that could be read by an independent processing system.

. There is no reason whatsoever that the processing system should have been able to read, translate and use the information that evolved separately in a different system.

. There is no reason whatsoever that these two systems should come together in the same molecule by the same blind, unguided, purposeless system.

Do atheists comprehend what it is they place their faith in? Certainly not the atheists posting here. You know what their answer is to these issues? Of course you do.

“Well Mak, it took millions of years!”

Es - ka - Pay

6 comments:

Ginx said...

No one is arguing the code is complex. What we're arguing is that over billions of years, it is not impossible for chemicals to come together in that fashion. Once the code is accidentally/randomly assembled once, it will self-replicate (all the trillions of other formations just float around, not replicating). It is only logical that chemical combinations that can self-replicate will be the ones which persist and become more numerous.

Elise said...

I wonder whether it's possible to debate this issue when the viewpoints are so far apart? Those of faith are going to see order within the chaos of this universe (as I do); atheists are going to see things differently, and probably the twain shall ne'er meet.

However, I am glad that there are folks like you, Mak, who use the brains that God gave us to discuss these issues.

Makarios said...

Not just complex. Specified complexity. The complexity has a message. It has instructions.

As well the cell has something that not only receives that message, it interprets the message and then carries out the instructions.

You're saying that information itself evolved. I don't buy it.

Makarios said...

Elise, I appreciate your comments and your support. The thing is, I’m not sure you want to hang around down here. This is not a very nice part of town. Ginx is cool. Most of the time. But some of the others, well, attacks can come out of no where. Not even I’m safe. You’re welcome to stay, of course, but wear your armour.

Ginx said...

If it comes to blows, I got your back Mak.

I'm not saying complex "coding" or "information" or "instructions" evolved. If they devise an experiment which can generate life from common, abiotic elements, then we'll know for sure. So far within our lifetime, we have devised experiments where all the necessary building blocks are shown to be present in early Earth conditions.

Your argument did not hold true for geography, where we have shown time and again that the landscape is shaped by the elements over long periods of time. I think you'll find the argument of "too complex to not be designed" will fall through for biology, as well.

I really wish you would address the logical conundrum of God's genesis. You are so honed in on looking for holes in scientific theories that are even openly debated by experts, yet you fall in line behind all the intellectually lazy believers when it comes to the theory of God's origin.

Always was? The infinite has no beginning or end? These are cute bumper stickers, but they aren't satisfying answers. If you seem frustrated, imagine how I feel! I'm being told that an abstract concept which is associated with a laughably inccorect creation story is actually a far more complex, philosophically mind-blowing being who is exists outside of time or space. That doesn't sound like the being who created the Earth in six days, that sounds like the rambling additions of centuries worth of theology trying to cover up the blatant holes in the source material.

Sometimes, it's like there's at least two Gods, often more, and believers irritatingly jump between the definitions without thought, because it's all one God to them.

Makarios said...

If it comes to blows, I got your back Mak.

Hmm, I wonder. Thanks for the offer, but I think I’ll just place my back against the wall.
===========

I'm not saying complex "coding" or "information" or "instructions" evolved.

Are you sure?
============

I really wish you would address the logical conundrum of God's genesis."

I don’t know how long you’ve been hanging around down here so I can’t believe you don’t remember that I have addressed this.

1) Matter is eternal - or
Creator God is eternal

2) If Matter isn’t eternal then Matter is able to bring itself into existence - or

Creator God brings matter into existence

3) Matter, against impossible odds, accidentally or purposely produces life - or

Creator God purposely produces life from Matter

4) Matter arranges and designs itself exquisitely and intricately - or

Creator God arranges and designs Matter exquisitely and intricately

5) Matter produces a life of meaning and context and purpose - NOT! - or

Creator God produces a life of meaning and context and purpose.

Here is what we know - scientifically and philosophically: . Everything that has a beginning has a cause for its beginning.

. The universe had a beginning.

. Therefore the beginning of the
universe had a cause.

That takes care of the silly question, “Well, if God made the universe, who made God?”

Remember, Ginx, atheists have no problem with saying that something is infinite, or that it has always existed, or that it’s eternal, as long as that something isn’t Creator God.

However, if God exists, then He exists outside of and prior to the universe. God is not material. He is Spirit. He does not need a cause. He has always been. He is infinite. He is eternal.

You're on the right track. The cause of the universe has to be eternal. We agree on that point.

However, Asking, “What caused an infinite or eternal Being to begin?” or, “When did an eternal being begin to exist?” is illogical and incoherent.

On your hypothesis that matter is eternal, you wouldn't turn around and ask, so what caused matter to exist? It's eternal. It's always existed. To ask about the origins of eternal matter would be illogical.

Illogical statements are something that atheists usually take great pains to avoid, EXCEPT when they’re confronted with the reality of Creator God. Then, it seems, all bets are off. The fact remains, and it remains a fact that is based on what science tells us is true, that everything that BEGINS TO EXIST, including the universe, had its cause from something outside of itself. There are no known exceptions to this observed and consistently verified rule.

We must choose between matter as infinite and Creator God who is Spirit, as infinite. Reason states that it must be One and not the other for matter cannot pre-exist itself either physically or chronologically, nor can matter bring itself into existence or create itself. Again, it is impossible for matter to be infinite or to exist from eternity past.
==================

Always was? The infinite has no beginning or end? These are cute bumper stickers, but they aren't satisfying answers.

Satisfying or not they are probably fact - in the case of the former, and absolutely fact in the case of the latter.

While mathematics is able to deal with abstract or theoretical or conceptual or potential infinities, reality holds no such possibility for us.
Matter is not imaginary.
Matter is not abstract or theoretical or conceptual.
Matter is real.
Matter is measured in real units.

The material infinite exists as a concept and only a concept.

As it stands, the evidence leaves us with Creator God as cause.