I began this series with:
“Nothing Did It” http://makarios-makarios.blogspot.com/2009/12/nothing-did-it.html
“Atheism of the Gaps” - http://makarios-makarios.blogspot.com/2009/12/atheism-of-gaps.html
“Es - ka - Pay” - http://makarios-makarios.blogspot.com/2009/12/es-ka-pay.html
“Please Read This” - http://makarios-makarios.blogspot.com/2009/12/please-read-this.html
“Which Came First” - http://makarios-makarios.blogspot.com/2009/12/which-came-first.html
“Why Would You Choose ID” - http://makarios-makarios.blogspot.com/2009/12/why-would-you-choose-id.html
Atheists are famous for joking that whenever Christians don’t have answers to difficult questions, we just say, “God did it.” Atheists joke about that because, well, that’s what Christians have traditionally done.
Atheists however have their own little quirks. The most famous, besides, “I don’t need God in order to be a good person,” is, “Chance did it.” For atheists, that line solves everything and anything to for which they don’t have an answer.
Got a life sustaining universe you can’t explain. Chance did it.
Got exquisitely finely tuned constants and qualities you can’t explain? Chance did it.
Got laws of logic and mathematics you can’t explain? Chance did it.
Got objective morals, values and obligations you can’t explain? Chance did it.
Got the most specifically complex information ever discovered and you can’t explain it? Chance did it.
Got life emerging from inorganic gases and can’t explain it? Chance did it.
Got a situation where you can’t think of any processes known to generate information-rich structures? Chance did it.
Given the similarities of our two religions, I’d say that “Chance did it,” is every bit as handy as, “God did it.”
“We now come to the critical moment in evolution in which the first semblance of ‘life’ appeared, through the CHANCE association of a number of abiotically formed macromolecular components.”
Albert Lehninger, “Biochemistry” 782.
At this point perhaps one could ask, What IS chance and can chance DO anything? When it comes to explaining away an Intelligent Consciousness, a Mind if you will, can “chance” get rid of the patterns that we find when examining our universe?
Here’s the problem for those who stake their futures on “chance did it.” If chance can nullify explanations for design, then the presence of a “Intelligent Design Pattern” nullifies “chance did it.” Why? Because the “chance did it” hypothesis is saying,
“There is nothing about this event that includes or brings to mind any regular or obvious causal factor.”
And since patterns, in this case patterns of design and of an Intelligent Designer indicate the presence of more than just chance, atheists must avoid at all cost recognising any patterns of unexplainable events for which an Intelligent Cause is a likely contributor. For a pattern of intelligent design would obviously destroy the chance hypothesis.
Of course, patterns alone don’t indicate an intelligent designer. However if you combine a very rare or even singular occurrence of an extraordinarily improbable event and recognise that this singular event is similar to other singularities, then “chance did it” becomes from the scientific method of discovery, less and less a likely causal factor.
Do you remember this, from the post “Nothing Did It”?
ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGG
CCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCC
GCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCG
CCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAG
GCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC
Even if by chance the nucleotide bases ACGT evolved, a trillion billion years would not be enough time to have them fall exactly into this sequence that CAUSES the building of an RNA polymerase. Arranging and rearranging letters or numbers has the ability to produce lots of UNSPECIFIED information, but it stands NO chance of creating specified information.
You doubt what I say? Between now and this time next week, take a bag of Scrabble letters, give them a shake and then pull out all the letters, one by one. Write down each letter in sequential order as you pull it out of the bag. Do this as many times as you can between now and next week and tell me how many paragraphs, sentences, or even words more than four letters long you find in that string of letters. Especially tell me when you get the sentence, “I love you. I’ll meet you after work.” Go ahead. Try it.
If you can’t do something as simple as that by chance, do you really expect that instructions (just a fraction of what’s needed are written above) that bring life into being happen by chance? If you saw someone win the lottery one hundred times in a row, would you believe it was chance? Of course not. If you saw someone draw a perfect hand in Bridge 10 times in a row, would you believe it was chance? Of course not.
Scientists have conducted “minimal complexity” experiments to find out just how simple can a cell be and still be a functional cell. The simplest extant cell, Mycoplasma genitalium - requires only 482 proteins to carry out its necessary functions. See my ACGT DNA code above? Count the number of letters if you wish.
This simplest of cells requires 562,000 bases of DNA to assemble those proteins.
10 perfect hands of bridge in a row isn’t by chance. You know it. I know it.
Dull of mind - Slow of thought, allows some people to believe that life aroe from non life by chance.
Subscribe to:
Post Comments (Atom)
4 comments:
Got a life sustaining universe you can’t explain. Chance did it.
How much of the universe is "life sustaining"?
We can infer from our own existence that life-sustaining universes are inevitable.
Got exquisitely finely tuned constants and qualities you can’t explain?
The reason that our own universe appears designed for human life is because we live in a tiny TINY part of our universe which happens to be life-friendly (to a degree); if we lived in a different type of life-supporting universe, then that too would appear fine-tuned for whatever type of life it supported.
Got laws of logic and mathematics you can’t explain? Chance did it.
The laws of logic are just observations.
Got objective morals, values and obligations you can’t explain? Chance did it.
First, morals and values can not be objective, you can't have morals and values without a mind. Second, we're group animals. Our sense of ethics evolved as part of that.
Got the most specifically complex information ever discovered and you can’t explain it? Chance did it.
First, natural selection explains the complexity of the "information". Second, you are confused about the word information again.
Here are some helpful links
http://en.wikipedia.org/wiki/Shannon_information
http://en.wikipedia.org/wiki/Self-information
At this point perhaps one could ask, What IS chance and can chance DO anything?
Chance does nothing. But events do occur which are "Having no definite aim or purpose; not sent or guided in a particular direction; made, done, occurring, etc., without method or conscious choice; haphazard..." (oxford). Not that chance has caused an event but the event has happened by chance.
Scientists have conducted “minimal complexity” experiments to find out just how simple can a cell be and still be a functional cell.
Not exactly. There are scientists interested in simple cells, which could be used as building blocks in the future.
The simplest extant cell, Mycoplasma genitalium - requires only 482 proteins to carry out its necessary functions.
Outdated information. Nearly every second year, an even simpler functioning cell has been sequenced. In 2006, Candidatus Carsonella ruddii was sequenced. Which is less than 185 proteins. RIKEN (Rikagaku Kenkyūsho) who sequenced this cell expect to sequence even simpler cells.
You doubt what I say? Between now and this time next week, take a bag of Scrabble letters, give them a shake and then pull out all the letters, one by one. Write down each letter in sequential order as you pull it out of the bag. Do this as many times as you can between now and next week and tell me how many paragraphs, sentences, or even words more than four letters long you find in that string of letters. Especially tell me when you get the sentence, “I love you. I’ll meet you after work.” Go ahead. Try it.
You're forgetting selection.
If you pulled out letters and abandoned ones that didn't fit, you would quickly have your message.
In nature, gene sequences that don't work (don't live, don't breed) don't spread. Natural selection.
Arranging and rearranging letters or numbers has the ability to produce lots of UNSPECIFIED information, but it stands NO chance of creating specified information.
"specified"? I thought you were going to use the word "information" in the Shannon sense...
"Specification depends on the knowledge of subjects. Is specification therefore subjective? Yes." (Dembski's book No Free Lunch, Page 66)
I have to go so have a look at this link instead:
http://en.wikipedia.org/wiki/Specified_complexity#Criticisms
From here:
1.There is no reason to think that the life around today is comparable in complexity to the earliest life. All of the simplest life would almost certainly be extinct by now, outcompeted by more complex forms.
2.Self-replicators can be incredibly simple, as simple as a strand of six DNA nucleotides (Sievers and von Kiedrowski 1994). This is simple enough to form via prebiotic chemistry. Self-replication sets the stage for evolution to begin, whether or not you call the molecules "life."
3.Nobody claims the first life arose by chance. To jump from the fact that the origin is unknown to the conclusion that it could not have happened naturally is the argument from incredulity.
Post a Comment