Nothing wrote this code. It just happened.
01010111011010000011001011011100010000001101001011
01110001000000111010001101000011001010010000001000
00110110111011101010111001000111001101100101001000
00011011110110011000100000011010000111010101101101
011000010110111000100000011001010111011001100101
011011100111010001110011001000000110100101110100
Know what that says in the American Standard Code for Information Interchange, i.e., Binary Code?
“When in the course of human events . . .”
Would it take intelligence to program a computer to write that and the rest of the Declaration of Independence in a manner that you could read on your computer?
I can’t think of anyone who would be dumb enough, biased enough or bigoted enough to doubt that intelligence is required.
ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGG
CCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCC
GCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCG
CCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAG
GCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC
How about this code? Do you think it took intelligent thought to construct this information in a manner that would allow for life to begin to exist? This is part of the sequence of genetic assembly instructions for constructing an RNA polymerase. This “machine code” is critical for information processing in a living cell. Without it being exactly as is - no working cell.
Watson and Crick, “Molecular Biology of the Gene,” 1:704
Many atheists have rightly mocked Christians who, when confronted by something unexplained, have said, “God did it.”
Atheists however do the exact same thing. When confronted by evidence that points directly to a Supreme Intelligence, atheists say, “Nothing did it!” It's simply atheism of the gaps.
Richard Dawkins says, “The machine code of the genes is uncannily computer-like.”
Richard Dawkins says, The above genetic code had nothing to do with intelligent design.
Richard Dawkins says, The above genetic code EVOLVED out of inorganic, inanimate gases which themselves evolved by blind, random mutations.
Atheists, who are by nature dull of mind and slow of thought accept this nonsense as gospel.
Subscribe to:
Post Comments (Atom)
13 comments:
To try to address your confusion, the reason these complex codes persist is because only a code that CAN persist WILL. Not a great answer? Not my field of study, nor is it even something we have that much information on.
For the record, evolution has nothing to do with abiogenesis (creation of life from non-living material, presumably through natural causes). How life began is a completely seperate issue which is only implied by evolution, and certainly never expressly explained by Darwin. How the universe began is a completely seperate issue, however.
The chronology of creation doesn't make much sense. If we reduce the whole universe to some point of creation, big bang or otherwise, the story isn't actually over.
Let's say God made the universe. In this model, what made God?
"God is self-creating."
Interesting quality, and quite convenient. Funny that the universe cannot possess this characteristic. Of course, through God all things are possible. I guess God tell a lie even He'll believe.
Perhaps God's ashamed of His family. That seems pretty familiar, and we are made in His image, afterall. Perhaps God had nothing to do with creation at all, and He just found us first. Maybe Nature is our real mother, as it appears to be Her laws which govern our universe. I don't see a lot of angels, demons, or miracles, like that God guy is always blathering about.
Perhaps what believers are trying to do is reduce the universe to some point where we can no longer explain, and then claim that God is the Unknown. If so, I feel bad for your God, because the unknown shrinks over time, so your God is losing influence as we learn more and more about how things actually work.
But I digress. I would be interested to hear how we need to explain who made the watch, but the watchmaker's very presence just goes without saying. Sure, the universe seems "complex," but that is a value judgment made by largely stupid beings trying desperately to grasp an understanding of it, so of course it seems complex to us. Perhaps it all very simple, and that the coding for life is merely a fraction as complex as the coding necessary to operate a Supreme Being on the order of God.
Explain me to where your God comes from, with great detail, and I'm sure by then we'll have the whole cosmos mapped out.
Also, I don't think I've ever read anything by Richard Dawkins. Do you imagine atheists all meeting up and listening to him preach from the pulpit?
Atheists are slow of thought? What does that make religious people, thoughtless?
For the record, evolution has nothing to do with abiogenesis"
I know that. This post is talking about abiogenesis.
=============
"God is self-creating."
No - God is Spirit - God is eternal. He does not need a start or a creations.
==================
Do you imagine atheists all meeting up and listening to him preach from the pulpit?
I thought he met with you in coffee shops.
=============
Atheists are slow of thought? What does that make religious people, thoughtless?
Ooo good one. I deserved it.
Oh, God is Eternal. Is this also a trait the universe is unable to possess?
Hate coffee, bleh...
Off to DC for a trip, I'll post pictures when I get back Sunday. This is the last thing I'm doing on my computer before shutting it off for the weekdend, though I should be able to use a friend's.
Honored? I hope so!
Is this also a trait the universe is unable to possess?
Correct. The material infinite does not exist.
I'll drink coffee if it's offered by otherwise not. Although I have taken to drinking green tea. Not because it tastes good. It seems to lower the bad stuff and raise the good stuff or something like that.
Hope you have a good trip.
I was just re reading your first response to this post Ginx and my goodness, did you ever say an awful lot of absolutely nothing. You could have just said, "I don't know what to say in the face of this evidence."
When confronted by evidence that points directly to a Supreme Intelligence,
There is no evidence to be confronted with. Provide some positive evidence of a supreme "intelligence" and you'll be famous!
atheists say, “Nothing did it!” It's simply atheism of the gaps.
Maybe you think -nature- is nothing but I don't.
And your phrase "atheism of the gaps" doesn't make sense. Atheists don't point to current gaps in knowledge as the reason to disbelieve.
Atheists, who are by nature dull of mind and slow of thought accept this nonsense as gospel.
All atheism is a lack of belief in gods.
Your ad hominems and arguments from ignorance have been noted.
. "There is no evidence to be confronted with"
. "Atheists, who are by nature dull of mind and slow of thought"
Oh my goodness, Chris. This is no example of ad hominem. The above two statements are intimately linked. Your statement could not exist without the reality of mine.
Is this the point where you provide some positive evidence of a supreme "intelligence"?
"Atheism of the gaps". Heh heh. Yes, I'm reading Signature in the Cell also Mak. It's great, isnt it?
"Atheism of the gaps"?
Do you agree that events or an event happens for natural causes?
(Not saying that there is no "supernatural" just because there is no evidence of the "supernatural")
I can't help you Chris. You have eyes that can't see and ears that can't hear. Nothing that I say will make any sense.
Nothing that I say will make any sense.
No comment.
Post a Comment