My man Gorth reminded me of Dawkins' ludicrous comments on luck and how lucky we are to have found ourselves in a universe that supports life-forms such as our own. That’s kind of like saying, “Ain’t it lucky that we found ourselves on a planet with water? Otherwise we’d have to drink wine all the time.
In his routine on luck, Dawkins also talks about how the magic of large numbers makes it all possible. Admitting in a back handed way that to say that life, the universe and everything as we know it came about by luck is profoundly ignorant, Dawkins throws out multi verses and says, “Now it all makes sense!” And you know what? Atheists believe him.
I talk about big numbers backed up by scientific fact in
http://makarios-makarios.blogspot.com/2009/12/last-post-on-chance.html
and atheists say "Boooo. Not possible."
Dawkins talks about an infinite number of universes, something for which there is not one speck of evidence and atheists throw their hats in the air (by the way, did anyone see the Canada / U.S. juniour hockey game tonight - yeah Canada) and yell, “Yeah, we’re saved. Thank you reverend Dawkins.”
Since Dawkins reminded me, and since there might be some newbies passing through this blog, this is a repost on just how lucky we are to be living in a universe such as ours.
I’ll start off with a line from Princeton physicist Freeman Dyson that to me is positively hilarious. In his comment,
- He’s referring to the constants and qualities that hold the cosmos together.
- He’s referring to the relationship between these constants that allow our biosphere to not only exist but to support intelligent life.
During his routine, Mr. Dyson says, “There are many lucky accidents in physics. Without such lucky accidents, life as we know it would be impossible.”
If you can’t see the humour in that chances are very good that you’re an atheist.
Other atheists look at the following information and say that to conclude that the evolution of "Us" was something other than luck or an amazing coincidence, i.e., God, is “jumping to conclusions.”
I feel like I’m repeating myself an awful lot but there are so many atheists who seem to have their feet planted firmly in thin air. They place their faith in pseudo evidence that hasn’t been thought through AT ALL! So, I’ll review once again.
Because of clear scientific evidence, we know that:
. Only in a universe so finely tuned as ours, could we expect observers such as ourselves to exist. Note: Fine Tuning is a neutral secular term in that it refers to constants and quantities (atomic weight, gravitational constant, strong & weak force, etc.) being just right for the existence of intelligent life. That’s in comparison with the huge range of possible values. In fact, the natural range of possible values is from 0 > 10 ^53 or from
0 - 1000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000.
If this number was conceptualized as a dartboard, the distance from one side of the dartboard to the other side would extended across the length of our entire Milky Way Galaxy. I’ll return to this comparison a little later. That being the case, let’s look at the ranges upon which our lives, our very existence depend.
It’s important to remember that the values of these constants and qualities were not something that evolved, or something that “settled in” as the universe aged. These constants were “put in” at the Big Bang. As well, you may be interested to note that the constants, quantities and values that are found in our cosmos appear to be unrelated in any way. They seem to be random, even arbitrary. In reality, they are independent of each other except for one thing. The only thing the constants, quantities and values of our universe have in common is that all of them, every single one of them need to be exactly as they are in order for intelligent life to exist on this planet. While there are around 100 constants and qualities, the most fundamental constants are the Fine Structure constant, the Gravitational constant, the Weak Force, the Strong Force and the Ratio between the mass of protons and electrons.
. What scientists, what ATHEIST scientists call an “astonishing coincidence” or “a lucky accident” is the following list of facts.
. Prior to the Big Bang, the ratio of the strong force to electromagnetism had to have been exactly as it was or else at 10 to -17 second after the start of the singularity, the necessary binding of helium -4, beryllium -8 and carbon -12 would not have occurred and life as we know it would not have appeared.
. The exact number and types of neutrinos at 1 second after the beginning of the Big Bang had to be in place or the expansion rate would have prohibited the formation of our universe.
. If the mass of a neutron were slightly increased by 1 part in 1,00000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000,0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000, then stable hydrogen burning stars would cease to exist.
. If the strong force were a long-range force (like electromagnetism or gravity) instead of a short range force that only acts between protons and neutrons in the nucleus, all matter would either instantaneously undergo nuclear fusion and explode or be sucked together forming a black hole.
Pretty lucky for us, huh, that all this just happened by chance? You sure wouldn’t want to think that maybe there was some intelligence behind this “amazing coincidence.” But that’s not all.
. If the Pauli-exclusion principle did not exist, all electrons would occupy the lowest atomic orbit, which would make complex chemical interactions impossible.
. If the quantization principle did not exist, there wouldn’t be any atomic orbits, electrons would be sucked into the nucleus and therefore no complex chemistry would be allowed.
. The gravitational constant must be EXACTLY 10 ^ 40 weaker than the Strong Nuclear Force or again, no us. For those that are interested, that’s ten thousand, billion, billion, billion, billion times weaker than the strong force.
Pretty lucky for us that it just happened to work out that way. I've been told that to suggest that it’s anything more than an amazing coincidence is jumping to conclusions.
A change of only 1 part in 10, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000 in the Gravitational constant as well as in the Weak Nuclear Force would prevent life from existing.
If the density of the universe and the speed of expansion had been off by one part in one hundred thousand million million, again, no life.
Remember, these values had to be put in prior to what is known as Planck time; that is, prior to 10 ^ - 43 second after the singularity.
How lucky do you feel so far?
The cosmological constant is what drives the inflation of the universe. It is tuned to 1 part in 10, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000,
0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000, 0000000000. Any variation greater than that in EITHER direction and - no universe.
Now, I mentioned this galaxy wide dartboard comparison. If the universe was an accident the values of these potential constants and quantities could potentially and theoretically fall anywhere within that area. The equation that I just gave you gives us a target within our galaxy wide dart board (get a picture of that) that is less than 2.5 centimetres in diameter. For us to exist, the values HAD to fall within that range.
Listen up now because here comes what atheists call the really lucky part. The amount of fine-tuning of the cosmological constant, one that we come upon, according to atheists, by accident and not by jumping to the conclusion of an intelligent designer, is like blindfolding yourself, spinning around ten times and then randomly firing a dart at our GALAXY wide dart board and hitting the target exactly in the centre of its 2.5 centimetre disk. Missing that target by any amount and - that’s right, no universe.
What I find sad and absolutely amazing is that if you’re an atheist, none of the above will be enough to convince you to consider Creator God as part of the equation. So let me use a different example.
The entropy per baryon that had to be “put in” PRIOR to Planck time is 1 part in 10 followed by 1,230 zeros. If that hadn’t been put in at the Big Bang our life supporting universe would not exist. This requires an extraordinarily precise arrangement of mass and energy. To hit this exactly right by accident, we would put on our blindfold, spin around ten times, and according to atheists, fire a dart randomly at the galaxy sized dart board and hit the exact CORRECT PROTON.
Let me put it in a slightly different manner. The distance from one edge of the Milky Way galaxy to the other edge is the potential distance or range for our constants and quantities. Travelling at the speed of light, that’s 100,000 years of travel.
. If the cosmological constant had varied any more than 2.5cms, no us, no life.
. If the entropy per baryon had varied any more than the width of ONE PROTON - no us, no life of any kind - No Universe!
And these aren’t even the most exquisite constants! Yet all of them (Dawkins would like you to think there are only six)HAD to be exactly as they are AT the Big Bang or no life. That is why these atheist scientists have said:
Arthur Eddington - “The beginning seems to present insuperable difficulties unless we agree to look at it as frankly supernatural.”
Nobel prize winner Arno Penzias - “The best data we have are exactly what I would have predicted had I nothing to go on but the five books of Moses, the Psalms, and the Bible as a whole.”
Stephen Hawking - “It would be very difficult to explain why the universe should have begun in just this way, except as the act of a God who intended to create beings like us.”
Physicist Freeman Dyson - ‘The more I examine the universe and study the details of its architecture, the more evidence I find that the universe in some sense must have known we were coming.”
Anthony Flew - The fine tuning of the universe at every level is simply too perfect to be the result of chance. Flew’s lifelong commitment “to go where the evidence leads” compelled him to become a believer in God.
Of this particular bunch, only Anthony Flew had the integrity to go with the evidence. Only Anthony Flew doesn't need the approval of his peer group to feel ok about himself.
If, by this point your mind isn’t numb with the credulity and gullibility that atheists force themselves to live with, I just don’t know what it would take to get you to throw up your hands and give up. I mean, just how blind does a person have to be before s/he willingly stops demanding the right to drive the car? This is not a joking matter any more. Atheist scientists have discovered this information. They know it, but obviously maintaining their bias against Creator God is worth throwing away their integrity. It’s embarrassing. It’s shameful. It should be a crime for them to teach “The Universe As An Accident” to your children.
Still not impressed? Listen up. Remember, these constants and qualities are independent of and unrelated to each other. There's no natural reason for any one of them to be just as they are. So, as astronomical are the odds of any one of them being just right for a life sustaining universe, to find all of them being as they are in the same universe, by accident is beyond comprehension. To figure out those odds, you would take, say, the Weak Force constant of 1 in 10^100, add to that the constant of gravitational constant 1 in 10^120, which gives you 10 ^ 100 + 120 + . . . and so on for ALL of the 100 + constants and quantities.
Still not impressed? Science states that anything beyond 10 ^ 50 is the same as impossible. On the one hand Stephen Hawking has said “If all the grains of sand on all the beaches of the Earth were possible universes, and only one of those grains of sand was a universe that allowed for the existence of intelligent life, then that one grain of sand is the universe we inhabit.” Yet on the other hand we know that Hawking remains an atheist. In the face of this evidence, why would Hawking or any atheist for that matter continue to search for natural solutions? They have to. In order to maintain their dogmatic, definite, deliberate denial of God’s existence, atheists must believe that the impossible is possible.
And that is why atheists say that we’re really, really lucky to be here.
That is why atheists say all this is just an amazing coincidence.
That is why atheists say there is no evidence for Creator God
That is why atheists say that any one who suggests that Creator God is involved in this miracle of life is just jumping to conclusions.
Thursday, December 31, 2009
Ezekiel 34:11 - 17 - I myself will search for my sheep and look after them. I look after my sheep. I will rescue them. I will pasture them. I will tend them in a good pasture. I myself will tend my sheep. I will search for them, the lost and the injured and strengthen the weak. I will shepherd the flock with justice.
Guess What’s Wrong
Guess what’s wrong with this statement.
“Natural sciences are completely evidence-based. Natural sciences demonstrate their conclusions only by appealing to that evidence. Evidence and evidence alone is what natural science uses to determine “truth.”
Anybody know what’s wrong with those statements? Is there anyone willing to admit that there IS something wrong with those statements? No, I didn’t think so.
“As a lover of truth, I am suspicious of strongly held beliefs that are unsupported by evidence.”
Anybody know who said that? Here’s a clue. He also said, “Perhaps as many as a billion planets in the universe host life.” Still don’t know? One last clue, “Once the vital ingredient - some kind of genetic molecule - is in place, true Darwinian natural selection can follow.”
“Once the vital ingredient is in place.” It cracks me up every time I hear that.
Of course our hero and mentor Dr. Richard Dawkins made those statements. Besides me, a greater hypocrite than Dawkins would be hard to find.
“Natural sciences are completely evidence-based. Natural sciences demonstrate their conclusions only by appealing to that evidence. Evidence and evidence alone is what natural science uses to determine “truth.”
Anybody know what’s wrong with those statements? Is there anyone willing to admit that there IS something wrong with those statements? No, I didn’t think so.
“As a lover of truth, I am suspicious of strongly held beliefs that are unsupported by evidence.”
Anybody know who said that? Here’s a clue. He also said, “Perhaps as many as a billion planets in the universe host life.” Still don’t know? One last clue, “Once the vital ingredient - some kind of genetic molecule - is in place, true Darwinian natural selection can follow.”
“Once the vital ingredient is in place.” It cracks me up every time I hear that.
Of course our hero and mentor Dr. Richard Dawkins made those statements. Besides me, a greater hypocrite than Dawkins would be hard to find.
So, there’s this guy -
My favorite group is Over the Rhine and my favorite song of theirs is “The Last Time I Saw Jesus” The first line of the song goes: The last time I saw Jesus, I was drinking Bloody Marys in the south. In a bar-room in New Orleans, rinsing out a bad taste in my mouth.”
There’s this guy in our congregation. Part of his story is, he remembers standing in the snow with a bottle of beer in his hand, “So drunk I could hardly stand.” And as he stood there in the cold, he was staring at a Church sign across the street that said, “Unless you be born again, you cannot see the kingdom of God.”
“I could not make sense of that verse so the next time I was sober I went to ask the Pastor what it meant.” And the rest, as they say, is history.
This guy is as precious as people come. Some think he’s mentally retarded. I think he just never had a proper education. He can read but didn't learn until in his late twenties. His childhood emotionally deprived.
. This guy takes steps daily to become spiritually, mentally, and emotionally clean.
. This guy meets with a small group, an accountability group on a regular basis with other guys who challenge each other toward truth and purity.
. This guy, regardless of victory or defeat is oriented toward his Lord and Saviour.
. This guy freely and openly admits his shortcomings and takes them to Jesus.
. This guy takes risks like asking - in Church - for prayer for a new job because he couldn’t support his family with the job he had - Two weeks later he had a new job with almost double the pay and benefits.
. This guy came to Jesus with nothing - absolutely nothing - no pretense - no education - no riches of any kind and today he gives away love and mercy and grace.
He is light and salt to the world. I want to be like this guy.
The last time I saw Jesus, I looked over my shoulder to the left and there he sat, with his wife and two children, dressed in t-shirt and jeans and so very in love with life. No pretending. Nothing fancy. Just humility and holiness and a longing to grow in love and purity.
There’s this guy in our congregation. Part of his story is, he remembers standing in the snow with a bottle of beer in his hand, “So drunk I could hardly stand.” And as he stood there in the cold, he was staring at a Church sign across the street that said, “Unless you be born again, you cannot see the kingdom of God.”
“I could not make sense of that verse so the next time I was sober I went to ask the Pastor what it meant.” And the rest, as they say, is history.
This guy is as precious as people come. Some think he’s mentally retarded. I think he just never had a proper education. He can read but didn't learn until in his late twenties. His childhood emotionally deprived.
. This guy takes steps daily to become spiritually, mentally, and emotionally clean.
. This guy meets with a small group, an accountability group on a regular basis with other guys who challenge each other toward truth and purity.
. This guy, regardless of victory or defeat is oriented toward his Lord and Saviour.
. This guy freely and openly admits his shortcomings and takes them to Jesus.
. This guy takes risks like asking - in Church - for prayer for a new job because he couldn’t support his family with the job he had - Two weeks later he had a new job with almost double the pay and benefits.
. This guy came to Jesus with nothing - absolutely nothing - no pretense - no education - no riches of any kind and today he gives away love and mercy and grace.
He is light and salt to the world. I want to be like this guy.
The last time I saw Jesus, I looked over my shoulder to the left and there he sat, with his wife and two children, dressed in t-shirt and jeans and so very in love with life. No pretending. Nothing fancy. Just humility and holiness and a longing to grow in love and purity.
Wednesday, December 30, 2009
Ya like hockey?
I was sitting in Church last Sunday. I was in this weird head space where - this hasn’t happened for a long time - I had tears running down my cheeks. I was just completely overwhelmed by how blessed I am. I was thinking about my wonderful family, and wonderful friends, and a wonderful Pastor and a house and yard that are perfect for our needs and on and on. I just felt sooo blessed by my Creator who loves me.
So at the end of the service I’m just sitting there, drained - exhausted - and a guy leans over and says, “Ya like hockey?” and I say, “Ya.” And he says, “Your boys like hockey?” And I say, “Ya.” And he reaches into his pocket and gives me four tickets to the World Junior Hockey Championships that are happening just down the street from our place.
When I was thinking about all the ways in which I’m blessed? I’d forgotten about hockey. The tickets are for next Sunday and I don't know who's playing but - eh - hockey's hockey - right?
So at the end of the service I’m just sitting there, drained - exhausted - and a guy leans over and says, “Ya like hockey?” and I say, “Ya.” And he says, “Your boys like hockey?” And I say, “Ya.” And he reaches into his pocket and gives me four tickets to the World Junior Hockey Championships that are happening just down the street from our place.
When I was thinking about all the ways in which I’m blessed? I’d forgotten about hockey. The tickets are for next Sunday and I don't know who's playing but - eh - hockey's hockey - right?
Peace!
“Blessed are the peacemakers for they will be called sons of God.” Matthew 5:9
“And God was in Christ reconciling the world to Himself.” I love that verse. Peacemakers go out of their way to heal the situation. It doesn’t matter that it isn’t fair. It doesn’t matter that the other person did wrong or even continues to do wrong. Reconciliation requires that someone do the hard thing and give peace to the other.
Of course, some might point out that we cannot give away what we do not ourselves possess. Hmm, good point. To make peace we must have peace, own peace, live peace, know peace.
“You don’t give a fuck about anybody, do you?” That line will stick with me till the day I die. Another lifetime ago, a co worker said that to me - with a tone of admiration if you can imagine.
Ah me, the pain of who I was, of who I am.
I’ve known violence. I’ve lived violence. I’ve loved violence.
While I’m a long, long way from who I want to be, need to be, this I know - Peace is not something manufactured. Nor, as the drug addicted wife abusing John Lennon once believed, is peace something that can be brought about by staying in bed for a long time.
. I now have peace because I received peace from the Author of peace.
. I now have peace because I am able to lean back into the warm and loving and protective arms of my Creator and Saviour.
. I now have peace because I know beyond all doubt that I can trust God in every area of my life.
. I now have peace because though I reside on earth, I am a citizen of heaven.
. I now have peace because I know that God will and does work in all circumstances for my good; the good of making me, little by little, more like Jesus.
What’s been broken, He restores. What’s been wounded, He heals.
. I now have peace NOT because I have it all figured out. I now have peace because I allowed my Lord and my Saviour Jesus the Christ to fill me with His peace.
“I lie down and sleep in peace, because you alone O Lord provide for my safety." Pslams
“And God was in Christ reconciling the world to Himself.” I love that verse. Peacemakers go out of their way to heal the situation. It doesn’t matter that it isn’t fair. It doesn’t matter that the other person did wrong or even continues to do wrong. Reconciliation requires that someone do the hard thing and give peace to the other.
Of course, some might point out that we cannot give away what we do not ourselves possess. Hmm, good point. To make peace we must have peace, own peace, live peace, know peace.
“You don’t give a fuck about anybody, do you?” That line will stick with me till the day I die. Another lifetime ago, a co worker said that to me - with a tone of admiration if you can imagine.
Ah me, the pain of who I was, of who I am.
I’ve known violence. I’ve lived violence. I’ve loved violence.
While I’m a long, long way from who I want to be, need to be, this I know - Peace is not something manufactured. Nor, as the drug addicted wife abusing John Lennon once believed, is peace something that can be brought about by staying in bed for a long time.
. I now have peace because I received peace from the Author of peace.
. I now have peace because I am able to lean back into the warm and loving and protective arms of my Creator and Saviour.
. I now have peace because I know beyond all doubt that I can trust God in every area of my life.
. I now have peace because though I reside on earth, I am a citizen of heaven.
. I now have peace because I know that God will and does work in all circumstances for my good; the good of making me, little by little, more like Jesus.
What’s been broken, He restores. What’s been wounded, He heals.
. I now have peace NOT because I have it all figured out. I now have peace because I allowed my Lord and my Saviour Jesus the Christ to fill me with His peace.
“I lie down and sleep in peace, because you alone O Lord provide for my safety." Pslams
I’ve Got the Answer
In the series I did on Intelligent Design I think it was Gorth who gave me some quotes from a guy who had all the answers. Scientists, he said, know how to figure it all out.
"What scientists actually postulate, and they postulate this with respect to every observable phenomenon in the universe, is that well defined and testable mechanisms are responsible."
Calilasseia
Can you imagine what it must be like for an atheist to think s/he has a real explanation for the beginning of life or the beginning of the universe but the explanation goes against everything we observe and know? (Snerk)
Sucks to be an atheist
"What scientists actually postulate, and they postulate this with respect to every observable phenomenon in the universe, is that well defined and testable mechanisms are responsible."
Calilasseia
Can you imagine what it must be like for an atheist to think s/he has a real explanation for the beginning of life or the beginning of the universe but the explanation goes against everything we observe and know? (Snerk)
Sucks to be an atheist
Tuesday, December 29, 2009
Not one of these atheist origin of the universe mythologies is supported by current scientific evidence.
Not one of them is supported by anything other than undiluted speculation.
Yet each and every one of them is acceptable to atheists and they are acceptable for only one reason.
They avoid the need for a Creator.
Not one of them is supported by anything other than undiluted speculation.
Yet each and every one of them is acceptable to atheists and they are acceptable for only one reason.
They avoid the need for a Creator.
We Are Sooo Far Behind
This from CNN - Some guy was caught by North Korea as he tried to cross the boarder from China. His intent was saving Dear Leader’s imperiled soul for Jesus. Ok, cool. But here is the truly Sci-Fi wonder part. Listen:
“The state-run Korea Central News Agency said the man was taken into custody after entering North Korea from China on December 24 and was "now under investigation by a relevant organ."
Eeeew! I mean I’m impressed and everything but - Eeeew! What if it's a giant stomach? I say, "Confess before it digests you!!!"
“The state-run Korea Central News Agency said the man was taken into custody after entering North Korea from China on December 24 and was "now under investigation by a relevant organ."
Eeeew! I mean I’m impressed and everything but - Eeeew! What if it's a giant stomach? I say, "Confess before it digests you!!!"
Monday, December 28, 2009
Atheist Dogma
I've said before that the atheist belief system certainly depends on faith and resembles a religion in terms of adhering to dogmatic beliefs. Richard Dawkins is one of the most dogmatic atheists currently on planet earth. So strident is his atheism that he’s called a “fundamentalist” in a pejorative sense even by other atheists. Now, when I use the term Dogma, I mean: Something held as an established opinion. Of course the main tenet of atheism is that there is no God. It may seem like a small point, but by that standard alone it is wrong to say that atheism holds no dogmatic beliefs. And if that were all to the atheist’s belief system then I suppose I should be writing about something else. But that isn’t all.
1)“Better by far to embrace the hard truth . . .”
Here Carl Sagan is instructing younger atheists what their attitude should be in the face of atheism’s hopelessness.
2)“We must develop expressions of awe and wonder regarding the workings of the Universe.” Carolyn Porco, Richard Dawkins.
This is now standard and expected fair when atheists are describing, to who ever will listen, what awesome individuals they are and how they will turn the next generation in to wonderful individuals as well.
3) All atheists must get out there and begin doing good works.
We’ve heard the now familiar call to all atheists to become good citizens. An example of this tenet can be found in the instruction for all atheists to donate blood during the World Day of Prayer. This demand that you become a good person is in contrast to the standard atheist attitude that was clearly sounded in a recent atheist blog when a young man, lamented, “Can’t I just fuck around and watch tv in the evening if I want to?”
4) No religion tells us what to do.
Only slaves feel enslaved and no one reacts negatively to rules, guidelines and authority more strongly than the immature, self-centred atheist. Simply hearing the word “God” used in a non negative manner makes atheists like Michael Newdow react like cockroaches scurrying from a freshly lit light bulb. Atheists feel stifled and imprisoned by the mere existence of religion.
The next six points of atheist dogma deal with one subject but are voiced in detailed point form because there is no room for misinterpretation in this part of the atheist belief system.
5) Nothing positive regarding God can be mentioned in the presence of children.
It is not science per se, not even evolution as such, but a special brand of anti-God-Darwinism that atheists want to be taught in the schools. A belief in God must be removed from ALL children’s minds. As Richard Dawkins preaches, “Faith is one of the world’s great evils, comparable to the small-pox virus but harder to eradicate.” The real reason that atheists want the exclusive teaching of evolution in schools is not just that atheists see it as being scientific but that they deem it to be anti-religion. Dawkins again, “Religion is capable of driving people to such dangerous folly that faith seems to me to qualify as a kind of mental illness.”
6) Teaching Christianity is harmful, even abusive to children.
Christopher Hitchens writes, “How can we ever know how many children had their psychological and physical lives irreparably maimed by the compulsory inculcation of faith?” The atheist answer? Inculcate all children with atheist beliefs.
7) Christian Children are not the property of their parents.
Daniel Dennett, “How much do we regard children as being the property of their parents? Should [Christian parents] be free to impose their beliefs on their children?”
Again, the atheist answer is to impose atheist beliefs upon not just their children but upon everyone’s children.
8) Atheists know best what children need to learn.
Christopher Hitchens suggests that atheists become the defenders of the world’s children, “Parents don’t literally own their children . . . [Christian parents] ought to be held accountable by outsiders (read atheists, perhaps the drunken Hitchens himself) for their guardianship, which does imply that outsiders have a right to interfere.”
9) Christian parents have no right to teach their children about Jesus.
Psychologist Nicholas Humphrey, “ [Christian] Parents, have no god-given license to enculturate their children in whatever way they choose . . . to bring them up in an atmosphere of dogma . . . or to insist they follow the straight and narrow paths of their own faith.”
While totally ignoring a Christian’s God-given mandate to raise up our children in the fear of the Lord, I’ve personally experienced this developing atheist dogma from an atheist blogger. His stated hope is that our children will be taken from us to keep them from being taught about Christianity. This of course implies the hope that someone else will raise our children and teach them the tenets of his faith.
10) Children must be taught a reverence for science.
Well, respect - yes, but reverence?
11) The beginning of the universe is the single exception to the 2nd Law of Thermodynamics.
True, no atheist would dare to state h/her beliefs this way. Yet, this is exactly what modern atheists in the field of origins are proposing. I had some goof propose to me just last week that the Steady State still holds promise for fundy atheists. Atheist scientists continue to bring forth proposal after proposal that attempts to circumvent this law.
12) No Miracles!
While the universe came into being by a force that operated outside the Laws of Physics, and while this is a working definition of a miracle, in atheist dogma, No Miracles Are Allowed Or Possible. As Lee Smolin says, “Must all of our scientific understanding of the world really come down to a mythological intelligence . . . [that] wills matter into being? It seems to me that the only possible name for such an observer is God, and that the theory is to be criticized as being unlikely on these grounds.”
13) It is a given that humans would eventually evolve in conditions present on primordial earth.
Atheists believe that against literally impossible odds, it is no accident that our kind of life finds itself on earth.
14) Evolution is such a powerful force that life is now, even as we speak, coming into being on other planets and/or in other universes.
15) Material and natural reality is all that exists.
16) Science has proven that God cannot exist.
Atheist High Priest Dawkins is beginning to bend on this one as even he can no longer deny that the cause of the Big Bang, presents a strong case for a “Deist” type of God. Nevertheless, the majority of hardliners still hold that >
17) Because God cannot be discovered through scientific inquiry, God does not exist.
“Modern science directly implies that the world is organised strictly in accordance with deterministic principles of chance. There are no purposive principles whatsoever in nature. There are no gods and no designing forces rationally detectable.” William Provine.
18) Any knowledge that does not conform to materialism and naturalism will not be allowed into the discussion.
Isn’t that amazing? Atheist scientists actually want to live with an a priori rejection of evidence, if that evidence does not fit the atheist scientist’s world-view. And even if that unacceptable evidence leads to a resolution of a given problem, to the atheist mind, it’s better to do without a resolution to the problem. While remaining slaves to the thinking with which they were born, atheists dare to call themselves free-thinkers. Pure delusion.
19) Reason and scientific inquiry can tell us all that we need to know and all that we can know.
20) Atheists are smarter than anyone who believes in God.
21) There is no “I” to the human animal. We are a mass of cells and neurons that operate according to the Laws of Nature.
As atheist actor Woody Allen stated in his defence after it was discovered that he was having sex with his daughter, “That heart wants what it wants. Who can understand it?”
22) Death is the end.
23) There is no cosmic purpose.
24) There is no Divine justice or reward.
25) Free will is an illusion.
26) Evil and suffering prove that God does not exist.
27) Living by these Beliefs, Tenets and Dogma of the atheist faith is emancipating.
The following individual best describes today’s modern atheist:
S/He is a lonely, intrepid figure, deprived of cosmic hope, abandoned to h/his own wits, navigating h/her way through the heavens, pitting h/herself against the unknown, refusing to accept the tyrannical sovereignty of God, rebelling against the divine decree, and determined to build out of h/his own resources a rival empire devoted to happiness in the here and now.
This of course is Milton’s description of satan in “Paradise Lost.”
In closing, it may need to be explained that any given atheist might say, “I don’t agree that this or that point is dogmatic atheism.” So what? Show me a member of any religion who doesn’t claim the right to disagree on some points.
1)“Better by far to embrace the hard truth . . .”
Here Carl Sagan is instructing younger atheists what their attitude should be in the face of atheism’s hopelessness.
2)“We must develop expressions of awe and wonder regarding the workings of the Universe.” Carolyn Porco, Richard Dawkins.
This is now standard and expected fair when atheists are describing, to who ever will listen, what awesome individuals they are and how they will turn the next generation in to wonderful individuals as well.
3) All atheists must get out there and begin doing good works.
We’ve heard the now familiar call to all atheists to become good citizens. An example of this tenet can be found in the instruction for all atheists to donate blood during the World Day of Prayer. This demand that you become a good person is in contrast to the standard atheist attitude that was clearly sounded in a recent atheist blog when a young man, lamented, “Can’t I just fuck around and watch tv in the evening if I want to?”
4) No religion tells us what to do.
Only slaves feel enslaved and no one reacts negatively to rules, guidelines and authority more strongly than the immature, self-centred atheist. Simply hearing the word “God” used in a non negative manner makes atheists like Michael Newdow react like cockroaches scurrying from a freshly lit light bulb. Atheists feel stifled and imprisoned by the mere existence of religion.
The next six points of atheist dogma deal with one subject but are voiced in detailed point form because there is no room for misinterpretation in this part of the atheist belief system.
5) Nothing positive regarding God can be mentioned in the presence of children.
It is not science per se, not even evolution as such, but a special brand of anti-God-Darwinism that atheists want to be taught in the schools. A belief in God must be removed from ALL children’s minds. As Richard Dawkins preaches, “Faith is one of the world’s great evils, comparable to the small-pox virus but harder to eradicate.” The real reason that atheists want the exclusive teaching of evolution in schools is not just that atheists see it as being scientific but that they deem it to be anti-religion. Dawkins again, “Religion is capable of driving people to such dangerous folly that faith seems to me to qualify as a kind of mental illness.”
6) Teaching Christianity is harmful, even abusive to children.
Christopher Hitchens writes, “How can we ever know how many children had their psychological and physical lives irreparably maimed by the compulsory inculcation of faith?” The atheist answer? Inculcate all children with atheist beliefs.
7) Christian Children are not the property of their parents.
Daniel Dennett, “How much do we regard children as being the property of their parents? Should [Christian parents] be free to impose their beliefs on their children?”
Again, the atheist answer is to impose atheist beliefs upon not just their children but upon everyone’s children.
8) Atheists know best what children need to learn.
Christopher Hitchens suggests that atheists become the defenders of the world’s children, “Parents don’t literally own their children . . . [Christian parents] ought to be held accountable by outsiders (read atheists, perhaps the drunken Hitchens himself) for their guardianship, which does imply that outsiders have a right to interfere.”
9) Christian parents have no right to teach their children about Jesus.
Psychologist Nicholas Humphrey, “ [Christian] Parents, have no god-given license to enculturate their children in whatever way they choose . . . to bring them up in an atmosphere of dogma . . . or to insist they follow the straight and narrow paths of their own faith.”
While totally ignoring a Christian’s God-given mandate to raise up our children in the fear of the Lord, I’ve personally experienced this developing atheist dogma from an atheist blogger. His stated hope is that our children will be taken from us to keep them from being taught about Christianity. This of course implies the hope that someone else will raise our children and teach them the tenets of his faith.
10) Children must be taught a reverence for science.
Well, respect - yes, but reverence?
11) The beginning of the universe is the single exception to the 2nd Law of Thermodynamics.
True, no atheist would dare to state h/her beliefs this way. Yet, this is exactly what modern atheists in the field of origins are proposing. I had some goof propose to me just last week that the Steady State still holds promise for fundy atheists. Atheist scientists continue to bring forth proposal after proposal that attempts to circumvent this law.
12) No Miracles!
While the universe came into being by a force that operated outside the Laws of Physics, and while this is a working definition of a miracle, in atheist dogma, No Miracles Are Allowed Or Possible. As Lee Smolin says, “Must all of our scientific understanding of the world really come down to a mythological intelligence . . . [that] wills matter into being? It seems to me that the only possible name for such an observer is God, and that the theory is to be criticized as being unlikely on these grounds.”
13) It is a given that humans would eventually evolve in conditions present on primordial earth.
Atheists believe that against literally impossible odds, it is no accident that our kind of life finds itself on earth.
14) Evolution is such a powerful force that life is now, even as we speak, coming into being on other planets and/or in other universes.
15) Material and natural reality is all that exists.
16) Science has proven that God cannot exist.
Atheist High Priest Dawkins is beginning to bend on this one as even he can no longer deny that the cause of the Big Bang, presents a strong case for a “Deist” type of God. Nevertheless, the majority of hardliners still hold that >
17) Because God cannot be discovered through scientific inquiry, God does not exist.
“Modern science directly implies that the world is organised strictly in accordance with deterministic principles of chance. There are no purposive principles whatsoever in nature. There are no gods and no designing forces rationally detectable.” William Provine.
18) Any knowledge that does not conform to materialism and naturalism will not be allowed into the discussion.
Isn’t that amazing? Atheist scientists actually want to live with an a priori rejection of evidence, if that evidence does not fit the atheist scientist’s world-view. And even if that unacceptable evidence leads to a resolution of a given problem, to the atheist mind, it’s better to do without a resolution to the problem. While remaining slaves to the thinking with which they were born, atheists dare to call themselves free-thinkers. Pure delusion.
19) Reason and scientific inquiry can tell us all that we need to know and all that we can know.
20) Atheists are smarter than anyone who believes in God.
21) There is no “I” to the human animal. We are a mass of cells and neurons that operate according to the Laws of Nature.
As atheist actor Woody Allen stated in his defence after it was discovered that he was having sex with his daughter, “That heart wants what it wants. Who can understand it?”
22) Death is the end.
23) There is no cosmic purpose.
24) There is no Divine justice or reward.
25) Free will is an illusion.
26) Evil and suffering prove that God does not exist.
27) Living by these Beliefs, Tenets and Dogma of the atheist faith is emancipating.
The following individual best describes today’s modern atheist:
S/He is a lonely, intrepid figure, deprived of cosmic hope, abandoned to h/his own wits, navigating h/her way through the heavens, pitting h/herself against the unknown, refusing to accept the tyrannical sovereignty of God, rebelling against the divine decree, and determined to build out of h/his own resources a rival empire devoted to happiness in the here and now.
This of course is Milton’s description of satan in “Paradise Lost.”
In closing, it may need to be explained that any given atheist might say, “I don’t agree that this or that point is dogmatic atheism.” So what? Show me a member of any religion who doesn’t claim the right to disagree on some points.
True Confessions
“Our willingness to accept scientific claims that are against common sense is the key to an understanding of the real struggle between science and the supernatural. We take the side of science in spite of the patent absurdity of some of its constructs, in spite of its failure to fulfill many of its extravagant promises of health and life, in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment to materialism. It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanation, no matter how counterintuitive, no matter how mystifying to the uninitiated. Moreover that materialism is absolute for we cannot allow a divine foot in the door.”
darwinist, Richard Lewontin, “Billions and Billions of Demons,” 31
As I saw in the series on Intelligent Design, beginning with the post “Nothing Did It” http://makarios-makarios.blogspot.com/2009/12/nothing-did-it.html
darwinists have defined science in such a way that the only possible answer to the information in DNA is materialism. This is not because what we observe leads us to believe that specific instructions come from random acts of mutation. They don’t. As Lewontin has confessed and as every atheist in the world knows, their commitment to materialism is a philosophical decision in search of evidence.
darwinist, Richard Lewontin, “Billions and Billions of Demons,” 31
As I saw in the series on Intelligent Design, beginning with the post “Nothing Did It” http://makarios-makarios.blogspot.com/2009/12/nothing-did-it.html
darwinists have defined science in such a way that the only possible answer to the information in DNA is materialism. This is not because what we observe leads us to believe that specific instructions come from random acts of mutation. They don’t. As Lewontin has confessed and as every atheist in the world knows, their commitment to materialism is a philosophical decision in search of evidence.
Sunday, December 27, 2009
Saturday, December 26, 2009
Calilasseia, on Getting an Education
In the comment section of my post (((Sigh)))Disappointing, Gorth attempted to enlighten me by cutting and pasting some comments by Calilasseia. It makes me sigh some more but the comments themselves require a reply. Calilasseia's comments are in quotations.
“Information is NOT a magic entity. It doesn't require magic to produce it.”
Calilasseia is correct of course. It does not require magic to produce the form of information that he is speaking of at this point. In fact, Calilasseia seems to be hoping that you think information is information is information. As an example, what's being suggested by Calilasseia, is that the sense of wind speed you get as you feel the wind on your face is information that's equal to the instructions the nurse uses to program the computer that controls your premature baby's respirator.
That may fly in atheist world, but in the real world specified or formulated information DOES require an Intelligent Agent to produce it, process it, translate it, actualise it, program it etc.. Give me an example where specified, formulated information does not require and Intelligent Agent for its presence and I'll quit posting about it.
================
“All that happens, in real world physical systems, is that different system states lead to different outcomes when the interactions within the system take place.”
Systems built by Intelligent Agents.
===================
“But this is precisely what we have with DNA”
Calilasseia has used a really good example in A Turing machine.
. For what is a Turing machine if not a theoretical device constructed by an Intelligent Agent?
. What but an Intelligent Agent assembles, constructs and / or uses logic?
. What but an Intelligent Agent constructs algorithms?
. What but Intelligent Agents construct thought experiments?
==========
“indeed, the DNA molecule plays a passive role in this: its function is simply to store the sequence of states that will result, ultimately, in the synthesis of a given protein.”
What but Intelligent Agents build storage systems for information? Are information storage systems built by Intelligent agents any less critical or impressive for being storage systems?
=============
“The real hard work is actually performed by the ribosomes,”
Yes, let's talk about the hard work, shall we? The ribozyme will not produce a single molecule with a functional specificity, or capacity to perform coordinate reactions, equivalent to that of the synthetases used in cells, yet without this specifificity and capacity to coordinate reactions, the construction of a sequence-specific arrangement of amino acids from the specific RNA transcript will not occur. In fact, RNA molecules possess very few of the specific enzymatic properties of proteins. They perform only a small handful of the thousands of functions performed by proteins.
I won't call Calilasseia a liar but one has to wonder why such a ridiculous statement would be made. The fact that Calilasseia is an atheist ideologue would be a safer bet.
---------------
“which take that state data and use it to bolt together amino acids into chains to form proteins,”
The whole question is, Where did the data come from?
--------------------
“whose job is to perform, mechanically and mindlessly in accordance with the electrostatic and chemical interactions permitting this, the construction of a protein using the information arising from DNA as the template.” (bold mine)
Again, the question is, Where did the information found in the DNA template come from? The information in the DNA did not form without the aid of a protein and the first protein did not form without the information in the DNA template.
As well, so what if it performs mindlessly. So does a computer but a computer does not perform at all without the information first put in by an Intelligent Agent.
------------------
“Anyone who thinks magic is needed in all of this, once again, is in need of an education.”
Anyone who thinks that specified, formulated information arises by mutation (of what?) before the DNA instructions are in place is in need of an education.
---------------
“the following sequence of hexadecimal bytes in a computer's memory:”
Who put it there in the first place you ignoramus?
--------------
“Indeed, it is entirely possible to regard ascribed meaning as nothing other than the particular interactions driven by the underlying data, once that data is being processed,”
Yes, and the data and the processor came from and were built by? An intelligent Agent.
----------------
“are in accord with observational reality to fifteen decimal places.”
Isn’t that cute? An atheist appeals to the magic of large numbers.
----------------
"What scientists actually postulate, and they postulate this with respect to every observable phenomenon in the universe, is that well defined and testable mechanisms are responsible." (bold mine)
Oh really?
. Observable and testable mechanisms bring something from nothing by no natural cause whatsoever?
. Observable and testable mechanisms bring forth life from inanimate and inorganic gases?
And both of these events which happened once and only once were observable?
I think Calilasseia used the term bullshit at one point. It can be used again right here.
-----------------
“Scroll down to "Induced mutations on the molecular level can be caused by:"
Let me finish, Intelligent Agents working towards a predetermined goal, something, I might add that does not exist in natural selection and most certainly did not exist prior to the fist living cell.
---------------------
“scientists have classified a number of well defined chemical reactions leading to mutations,”
I believe it was Daniel Dennett who said that there is only “1 helpful mutation in every 500 TRILLION copyings.” Yes, I know. It took a long time.
==============
"you believe nothing created the universe"
That’s not quite accurate. It’s, “Nothing natural created the universe” since at the time of the singularity, nothing natural existed, at least according to science.
==============
“scientists postulate that well defined and testable natural mechanisms, operating upon the appropriate entities,”
I do wish he would tell us WHAT these entities were (no Matter existed) and WHERE they were at the singularity (no Space existed), or is he expecting us to know which atheist origin of the universe mythology is being used as a canard in this instance?
“Information is NOT a magic entity. It doesn't require magic to produce it.”
Calilasseia is correct of course. It does not require magic to produce the form of information that he is speaking of at this point. In fact, Calilasseia seems to be hoping that you think information is information is information. As an example, what's being suggested by Calilasseia, is that the sense of wind speed you get as you feel the wind on your face is information that's equal to the instructions the nurse uses to program the computer that controls your premature baby's respirator.
That may fly in atheist world, but in the real world specified or formulated information DOES require an Intelligent Agent to produce it, process it, translate it, actualise it, program it etc.. Give me an example where specified, formulated information does not require and Intelligent Agent for its presence and I'll quit posting about it.
================
“All that happens, in real world physical systems, is that different system states lead to different outcomes when the interactions within the system take place.”
Systems built by Intelligent Agents.
===================
“But this is precisely what we have with DNA”
Calilasseia has used a really good example in A Turing machine.
. For what is a Turing machine if not a theoretical device constructed by an Intelligent Agent?
. What but an Intelligent Agent assembles, constructs and / or uses logic?
. What but an Intelligent Agent constructs algorithms?
. What but Intelligent Agents construct thought experiments?
==========
“indeed, the DNA molecule plays a passive role in this: its function is simply to store the sequence of states that will result, ultimately, in the synthesis of a given protein.”
What but Intelligent Agents build storage systems for information? Are information storage systems built by Intelligent agents any less critical or impressive for being storage systems?
=============
“The real hard work is actually performed by the ribosomes,”
Yes, let's talk about the hard work, shall we? The ribozyme will not produce a single molecule with a functional specificity, or capacity to perform coordinate reactions, equivalent to that of the synthetases used in cells, yet without this specifificity and capacity to coordinate reactions, the construction of a sequence-specific arrangement of amino acids from the specific RNA transcript will not occur. In fact, RNA molecules possess very few of the specific enzymatic properties of proteins. They perform only a small handful of the thousands of functions performed by proteins.
I won't call Calilasseia a liar but one has to wonder why such a ridiculous statement would be made. The fact that Calilasseia is an atheist ideologue would be a safer bet.
---------------
“which take that state data and use it to bolt together amino acids into chains to form proteins,”
The whole question is, Where did the data come from?
--------------------
“whose job is to perform, mechanically and mindlessly in accordance with the electrostatic and chemical interactions permitting this, the construction of a protein using the information arising from DNA as the template.” (bold mine)
Again, the question is, Where did the information found in the DNA template come from? The information in the DNA did not form without the aid of a protein and the first protein did not form without the information in the DNA template.
As well, so what if it performs mindlessly. So does a computer but a computer does not perform at all without the information first put in by an Intelligent Agent.
------------------
“Anyone who thinks magic is needed in all of this, once again, is in need of an education.”
Anyone who thinks that specified, formulated information arises by mutation (of what?) before the DNA instructions are in place is in need of an education.
---------------
“the following sequence of hexadecimal bytes in a computer's memory:”
Who put it there in the first place you ignoramus?
--------------
“Indeed, it is entirely possible to regard ascribed meaning as nothing other than the particular interactions driven by the underlying data, once that data is being processed,”
Yes, and the data and the processor came from and were built by? An intelligent Agent.
----------------
“are in accord with observational reality to fifteen decimal places.”
Isn’t that cute? An atheist appeals to the magic of large numbers.
----------------
"What scientists actually postulate, and they postulate this with respect to every observable phenomenon in the universe, is that well defined and testable mechanisms are responsible." (bold mine)
Oh really?
. Observable and testable mechanisms bring something from nothing by no natural cause whatsoever?
. Observable and testable mechanisms bring forth life from inanimate and inorganic gases?
And both of these events which happened once and only once were observable?
I think Calilasseia used the term bullshit at one point. It can be used again right here.
-----------------
“Scroll down to "Induced mutations on the molecular level can be caused by:"
Let me finish, Intelligent Agents working towards a predetermined goal, something, I might add that does not exist in natural selection and most certainly did not exist prior to the fist living cell.
---------------------
“scientists have classified a number of well defined chemical reactions leading to mutations,”
I believe it was Daniel Dennett who said that there is only “1 helpful mutation in every 500 TRILLION copyings.” Yes, I know. It took a long time.
==============
"you believe nothing created the universe"
That’s not quite accurate. It’s, “Nothing natural created the universe” since at the time of the singularity, nothing natural existed, at least according to science.
==============
“scientists postulate that well defined and testable natural mechanisms, operating upon the appropriate entities,”
I do wish he would tell us WHAT these entities were (no Matter existed) and WHERE they were at the singularity (no Space existed), or is he expecting us to know which atheist origin of the universe mythology is being used as a canard in this instance?
True Christmas Story
My wife and her sister look alike. They REALLY look alike. Have I told this story? Eh, I’ll tell it again.
They look so much alike that when I got my graduate degree, one of our friends, someone that we saw every single week, went up to Wendy’s sister and said something like, “So Rod did it!” My sister-in-law said, “I bet you think you're talking to Wendy.”
They really look alike. Anyhow -
About 10 years ago we had some people over for a meal during the holidays. My wife’s sister and husband were among the guests. As it turned out, my wife and her sister were wearing the same outfit so they looked even more alike than usual. After a good meal we all rose from the table and were just kind of standing around, holding our drinks and visiting. The mood was very friendly and close and perhaps even romantic could have been used to describe the atmosphere. I was holding my wife from behind, my hands on her hips, pulling her close, kinda rocking back and forth.
Then something unusual happened.
From where I was standing I could see that the neighbour’s porch light was being turned on and off. I went to look out the window and as I walked to the door, I glanced into the adjoining room. Imagine my surprise to see my WIFE arranging some gifts under the tree.
My wife was in another room!
If my wife was in a different room, who was I holding REALLY close? I whirled around to see my sister-in-law with a look on her face that words really can't describe.
I’m lucky that I didn’t get a broken nose from her elbow.
They look so much alike that when I got my graduate degree, one of our friends, someone that we saw every single week, went up to Wendy’s sister and said something like, “So Rod did it!” My sister-in-law said, “I bet you think you're talking to Wendy.”
They really look alike. Anyhow -
About 10 years ago we had some people over for a meal during the holidays. My wife’s sister and husband were among the guests. As it turned out, my wife and her sister were wearing the same outfit so they looked even more alike than usual. After a good meal we all rose from the table and were just kind of standing around, holding our drinks and visiting. The mood was very friendly and close and perhaps even romantic could have been used to describe the atmosphere. I was holding my wife from behind, my hands on her hips, pulling her close, kinda rocking back and forth.
Then something unusual happened.
From where I was standing I could see that the neighbour’s porch light was being turned on and off. I went to look out the window and as I walked to the door, I glanced into the adjoining room. Imagine my surprise to see my WIFE arranging some gifts under the tree.
My wife was in another room!
If my wife was in a different room, who was I holding REALLY close? I whirled around to see my sister-in-law with a look on her face that words really can't describe.
I’m lucky that I didn’t get a broken nose from her elbow.
It’s a Gimme!
“The probability of getting one protein molecule by chance would be the same as a blindfolded person finding one marked grain of sand in the Sahara Desert three times in a row.”
“The probability of getting one protein molecule, by chance, is the same as a blindfolded person choosing the correct marked atom from the whole universe.”
These two comments highlight the improbability of, well, you know, Chance being responsible for generating one protein molecule. Richard Dawkins, who on the one hand claims to shy away from outcomes with a high improbability, on the other hand says that the rise of life from non life is a gimme.
To get life, you need about 200 proteins - together. Here’s the catch.
DNA is dependent on proteins for its production, but
Proteins are dependent on DNA for their production.
Atheists see no problem because, if “nature did it” well, then, it’s a gimme.
Why? Nature brings order. So say the atheists.
In reality, nature left to itself brings disorder.
Well, ok, that SEEMS true, says your friendly neighbourhood atheist - unless - you give nature lots and lots of time. Then for some reason, the opposite happens. According to atheists, if you give nature lots and lots of time, and I mean A LOT of time, then, again according to atheists, The Second Law of Thermodynamics no longer applies and order comes from disorder - naturally.
So say atheists. In fact, “It’s a gimme.”
“The probability of getting one protein molecule, by chance, is the same as a blindfolded person choosing the correct marked atom from the whole universe.”
These two comments highlight the improbability of, well, you know, Chance being responsible for generating one protein molecule. Richard Dawkins, who on the one hand claims to shy away from outcomes with a high improbability, on the other hand says that the rise of life from non life is a gimme.
To get life, you need about 200 proteins - together. Here’s the catch.
DNA is dependent on proteins for its production, but
Proteins are dependent on DNA for their production.
Atheists see no problem because, if “nature did it” well, then, it’s a gimme.
Why? Nature brings order. So say the atheists.
In reality, nature left to itself brings disorder.
Well, ok, that SEEMS true, says your friendly neighbourhood atheist - unless - you give nature lots and lots of time. Then for some reason, the opposite happens. According to atheists, if you give nature lots and lots of time, and I mean A LOT of time, then, again according to atheists, The Second Law of Thermodynamics no longer applies and order comes from disorder - naturally.
So say atheists. In fact, “It’s a gimme.”
Do you long for righteousness?
"Blessed are those who hunger and thirst for righteousness, for they will be filled.” Matthew 5:6
Do you remember when you first fell in love? You wanted to be with that person. You wanted to talk to that person. Your thoughts were nearly always about that person.
That’s what it’s like to hunger and thirst for righteousness. Once you’ve tasted the goodness of God, once you’ve experienced the righteousness of God and the consequences of a righteous life, it’s like falling in love.
When we’re in love with righteousness our desires begin to line up with God’s desires. His purpose and plans for us begin to match our longings. Our decisions are cross-checked through what we know of God’s desires for us. Our love for others begins to mirror His love for us. When this happens, we are fortunate, favoured, blessed.
The more we know and experience the love of God, the more we crave and hunger for His righteousness. The more we witness the tragedy of the world, the more we hunger and thirst for righteousness.
Love the Lord your God with all your mind, heart, soul and strength.
When we are poor in spirit, or mourning, when we are meek and when we hunger and thirst for righteousness, we are indeed blessed.
“Like newborn babies, crave pure spiritual milk, so that by it your may grow up in your salvation.” 1st Peter 2:2
Do you remember when you first fell in love? You wanted to be with that person. You wanted to talk to that person. Your thoughts were nearly always about that person.
That’s what it’s like to hunger and thirst for righteousness. Once you’ve tasted the goodness of God, once you’ve experienced the righteousness of God and the consequences of a righteous life, it’s like falling in love.
When we’re in love with righteousness our desires begin to line up with God’s desires. His purpose and plans for us begin to match our longings. Our decisions are cross-checked through what we know of God’s desires for us. Our love for others begins to mirror His love for us. When this happens, we are fortunate, favoured, blessed.
The more we know and experience the love of God, the more we crave and hunger for His righteousness. The more we witness the tragedy of the world, the more we hunger and thirst for righteousness.
Love the Lord your God with all your mind, heart, soul and strength.
When we are poor in spirit, or mourning, when we are meek and when we hunger and thirst for righteousness, we are indeed blessed.
“Like newborn babies, crave pure spiritual milk, so that by it your may grow up in your salvation.” 1st Peter 2:2
Friday, December 25, 2009
And The Winner Is -
In the category, Dumbest Comment by an Atheist, the winner for 2009 goes to, “Scripto”
In my series on Intelligent Design which dealt solely with the question, “What is the origin of the information that made first life possible” for a post titled, “Got Junk” http://makarios-makarios.blogspot.com/2009/12/got-junk.html this year's winner left the following comment.
“Most of those papers you site are not peer reviewed in the appropriate journals. Those that are deal with a specific area of evolutionary theory that may or may not be called into question by their conclusions. In no case do they offer ID as a supportable alternative. And in no case have they made any headway in biological journals. I'm looking for independent corroboration . . .
Translation:
If a Christian submits a scientific paper for peer review, it doesn’t count if it was reviewed by h/her peers, i.e., other scientists who are also Christians.
I’ll only accept a scientific paper written by a Christian if it was reviewed by someone who holds a hostile and contrary view to that of the paper in question.
---------------
Scripto's comments and those of his peers who commented throughout the series fit well this discription of atheist readers by another Christian blogger.
"Actually, the biggest problem that the New Atheists face is their fundamental dishonesty. They frequently dissemble, exaggerate, and lie. They also practice the fundamental bait-and-switch of selling a specific secular philosophy under the guise of science. They are deeply and profoundly ignorant of history, economics, politics, and theology; worst of all, when they are called out and shown to be ignorant, they do not bother to take their errors into account or alter their conclusions in the slightest.
This is what makes them irreligious fundamentalists. Indeed, the average New Atheist is demonstrably more blindly fundamentalist than the average Christian or Islamic fundamentalist. There is literally no information that is capable of changing their position because it is based on raw emotion, not reason, logic, or science. Because they cannot admit error, every dialogue with a New Atheist will inevitably turn into an intellectual fox chase, with the New Atheist frantically attempting to redefine basic dictionary terms, claiming that he didn't mean what he previously wrote, moving the goal posts every time his previous position is shown to be incorrect, and attempting to change the subject whenever logical or factual errors in some aspect of his individual belief system are pointed out. The very concept of a New Atheist "intellectual" is a contradiction in terms, because New Atheists are uniformly close-minded ideologues. And by uniformly, I mean without exception. I have yet to encounter one. Reasonable atheists don't subscribe to the Dawkinsian myths. We have seen this again and again on this blog, and no doubt we will continue to see it until they fade from the scene as all of their predecessors have before them."
In my series on Intelligent Design which dealt solely with the question, “What is the origin of the information that made first life possible” for a post titled, “Got Junk” http://makarios-makarios.blogspot.com/2009/12/got-junk.html this year's winner left the following comment.
“Most of those papers you site are not peer reviewed in the appropriate journals. Those that are deal with a specific area of evolutionary theory that may or may not be called into question by their conclusions. In no case do they offer ID as a supportable alternative. And in no case have they made any headway in biological journals. I'm looking for independent corroboration . . .
Translation:
If a Christian submits a scientific paper for peer review, it doesn’t count if it was reviewed by h/her peers, i.e., other scientists who are also Christians.
I’ll only accept a scientific paper written by a Christian if it was reviewed by someone who holds a hostile and contrary view to that of the paper in question.
---------------
Scripto's comments and those of his peers who commented throughout the series fit well this discription of atheist readers by another Christian blogger.
"Actually, the biggest problem that the New Atheists face is their fundamental dishonesty. They frequently dissemble, exaggerate, and lie. They also practice the fundamental bait-and-switch of selling a specific secular philosophy under the guise of science. They are deeply and profoundly ignorant of history, economics, politics, and theology; worst of all, when they are called out and shown to be ignorant, they do not bother to take their errors into account or alter their conclusions in the slightest.
This is what makes them irreligious fundamentalists. Indeed, the average New Atheist is demonstrably more blindly fundamentalist than the average Christian or Islamic fundamentalist. There is literally no information that is capable of changing their position because it is based on raw emotion, not reason, logic, or science. Because they cannot admit error, every dialogue with a New Atheist will inevitably turn into an intellectual fox chase, with the New Atheist frantically attempting to redefine basic dictionary terms, claiming that he didn't mean what he previously wrote, moving the goal posts every time his previous position is shown to be incorrect, and attempting to change the subject whenever logical or factual errors in some aspect of his individual belief system are pointed out. The very concept of a New Atheist "intellectual" is a contradiction in terms, because New Atheists are uniformly close-minded ideologues. And by uniformly, I mean without exception. I have yet to encounter one. Reasonable atheists don't subscribe to the Dawkinsian myths. We have seen this again and again on this blog, and no doubt we will continue to see it until they fade from the scene as all of their predecessors have before them."
The Flat Universe Society
A couple posts ago I stated, “Scientists tell us that the universe is flat. Do you know what that means?
Do you know what it would take to change it to something other than flat?”
. One atheist said that he asked his physics prof, but apparently he’s decided against sharing what he learned. He's letting me do this first.
. Another left the comment-
“==========
These lines represent the flatness?”
Well, ok. I can use that concept. However, before returning to that, another way of looking at the issue is, at Big Bang the universe inflated to enormous dimensions literally in the twinkling of an eye. Just as the earth “appears” flat to someone with a very limited perspective from where we stand, so too the universe. However, the flat universe issue is describing, I think, much more than perception.
Unless I’m wrong, a flat universe is describing the room or lack thereof for variance in order for our universe, our life supporting universe to exist. The variance is determined in large part by the cosmological constant. The cosmological constant is what drives the inflation of the universe. It is tuned to 1 part in 1,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000.
As suggested above, this can be represented by = = = = = = = = = =
Any variation in either direction (eg, 800 parts vs. 1 part, 50 parts vs. 1 part, 2 parts vs. 1 part, or even 1.00001 parts) more than 1 part in 1,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000, 000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000
and there would be - no universe. I don’t mean, no universe NOW. I mean if this exact constant had not been put in place at Planck time, the universe would not have EVER existed.
A DECREASE in the rate of expansion less than = = = = = = = = = = and the universe would have re collapsed.
An INCREASE more than = = = = = = = = = = and no galaxies would have been able to form.
At 10 ^ -43 second after the Big Bang, the density of the universe must have been within = = = = = = = = = = of the critical density at which space is flat.
Roger Penrose has calculated that having this exquisite fine tuning taking place by accident, without any “constraining principle” being put in AT Planck Time to be 10 ^ 1,230. “The Road to Reality” 762-765.
What I’m talking about has nothing to do with the Law of Large Numbers. This has to do with exquisitely unimaginably finely tuned constants and qualities.
Even though the number of sub atomic particles in the whole universe is 10 ^ 80
Even though “impossible” is calculated to be 10 ^ 50 or greater
Even though Penrose says the possibility of our being here by accident to be 10 ^ 1,230
Atheists say this all happened by chance.
No logic? No problem. Atheists just say whatever needs to be said in order to preserve their delusion. And if you dare challenge their delusion, well then, you’re anti intellectual, anti science, anti progress.
It’s not easy for someone to live with such a cognitive disconnect whereby on the one hand the atheist says, I’m intelligent, reasonable, and logical, yet on the other hand say “One hundred finely tuned constants and qualities came together, as they are today, all at once in Planck time - and it was just luck.
In fact, it’s such a disconnect that a growing percentage of atheists have reasonably decided that someone is going to find out that the Chance hypothesis is just plain ridiculous. They’re right.
Sadly, preferring to sound like the village idiot rather than admit to anything that smacks of Design, atheists invented an origin of the universe mythology that says there are - wait for it - an INFINITE NUMBER of universes. Isn’t that just like something a Bright would say? With an infinite number of chances to give chance a chance of working, atheists tell us that it just stands to “reason” that somewhere within an infinite number of universes, there would be one universe where all the constants required for a life-supporting universe were put into place at Planck time by . . . . . . . . ta da! - Chance.
If you don’t mind believing in something for which there is absolutely no evidence, this multi verse mythology sounds like a really good idea.
It’s not a good idea.
In fact it’s a terrible idea. While the multi verse mythology is a compliment to the veracity of the Design hypothesis, it makes worse the very problem that atheists were hoping to make go away.
First of all, there is no such thing and in fact there cannot be such a thing as a material infinite - of anything. What’s more, if there WERE an infinite number of universes (life supporting or not) each and every one of them would need similar constants to get started AND to remain in existence, as is the case with ours. Positing an infinite number of universes doesn’t eliminate the problem. Rather than making the atheist’s problem go away, atheists have just INCREASED their problems by an infinite degree.
A multi verse mythology doesn’t multiply the chances of our life-supporting universe existing. An absurd multi verse mythology multiplies the absurdities of atheism.
As atheists are discovering, Extreme evidence like a finely tuned life-supporting universe requires extremely absurd mythologies to explain it away.
“A common sense interpretation of the facts suggest that a super intellect has monkeyed with physics, as well as chemistry and biology, and that there are no blind forces worth speaking about in nature.”
Astronomer Fred Hoyle, “The Universe: Past and Present Reflections” 12
Do you know what it would take to change it to something other than flat?”
. One atheist said that he asked his physics prof, but apparently he’s decided against sharing what he learned. He's letting me do this first.
. Another left the comment-
“==========
These lines represent the flatness?”
Well, ok. I can use that concept. However, before returning to that, another way of looking at the issue is, at Big Bang the universe inflated to enormous dimensions literally in the twinkling of an eye. Just as the earth “appears” flat to someone with a very limited perspective from where we stand, so too the universe. However, the flat universe issue is describing, I think, much more than perception.
Unless I’m wrong, a flat universe is describing the room or lack thereof for variance in order for our universe, our life supporting universe to exist. The variance is determined in large part by the cosmological constant. The cosmological constant is what drives the inflation of the universe. It is tuned to 1 part in 1,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000.
As suggested above, this can be represented by = = = = = = = = = =
Any variation in either direction (eg, 800 parts vs. 1 part, 50 parts vs. 1 part, 2 parts vs. 1 part, or even 1.00001 parts) more than 1 part in 1,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000, 000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000
and there would be - no universe. I don’t mean, no universe NOW. I mean if this exact constant had not been put in place at Planck time, the universe would not have EVER existed.
A DECREASE in the rate of expansion less than = = = = = = = = = = and the universe would have re collapsed.
An INCREASE more than = = = = = = = = = = and no galaxies would have been able to form.
At 10 ^ -43 second after the Big Bang, the density of the universe must have been within = = = = = = = = = = of the critical density at which space is flat.
Roger Penrose has calculated that having this exquisite fine tuning taking place by accident, without any “constraining principle” being put in AT Planck Time to be 10 ^ 1,230. “The Road to Reality” 762-765.
What I’m talking about has nothing to do with the Law of Large Numbers. This has to do with exquisitely unimaginably finely tuned constants and qualities.
Even though the number of sub atomic particles in the whole universe is 10 ^ 80
Even though “impossible” is calculated to be 10 ^ 50 or greater
Even though Penrose says the possibility of our being here by accident to be 10 ^ 1,230
Atheists say this all happened by chance.
No logic? No problem. Atheists just say whatever needs to be said in order to preserve their delusion. And if you dare challenge their delusion, well then, you’re anti intellectual, anti science, anti progress.
It’s not easy for someone to live with such a cognitive disconnect whereby on the one hand the atheist says, I’m intelligent, reasonable, and logical, yet on the other hand say “One hundred finely tuned constants and qualities came together, as they are today, all at once in Planck time - and it was just luck.
In fact, it’s such a disconnect that a growing percentage of atheists have reasonably decided that someone is going to find out that the Chance hypothesis is just plain ridiculous. They’re right.
Sadly, preferring to sound like the village idiot rather than admit to anything that smacks of Design, atheists invented an origin of the universe mythology that says there are - wait for it - an INFINITE NUMBER of universes. Isn’t that just like something a Bright would say? With an infinite number of chances to give chance a chance of working, atheists tell us that it just stands to “reason” that somewhere within an infinite number of universes, there would be one universe where all the constants required for a life-supporting universe were put into place at Planck time by . . . . . . . . ta da! - Chance.
If you don’t mind believing in something for which there is absolutely no evidence, this multi verse mythology sounds like a really good idea.
It’s not a good idea.
In fact it’s a terrible idea. While the multi verse mythology is a compliment to the veracity of the Design hypothesis, it makes worse the very problem that atheists were hoping to make go away.
First of all, there is no such thing and in fact there cannot be such a thing as a material infinite - of anything. What’s more, if there WERE an infinite number of universes (life supporting or not) each and every one of them would need similar constants to get started AND to remain in existence, as is the case with ours. Positing an infinite number of universes doesn’t eliminate the problem. Rather than making the atheist’s problem go away, atheists have just INCREASED their problems by an infinite degree.
A multi verse mythology doesn’t multiply the chances of our life-supporting universe existing. An absurd multi verse mythology multiplies the absurdities of atheism.
As atheists are discovering, Extreme evidence like a finely tuned life-supporting universe requires extremely absurd mythologies to explain it away.
“A common sense interpretation of the facts suggest that a super intellect has monkeyed with physics, as well as chemistry and biology, and that there are no blind forces worth speaking about in nature.”
Astronomer Fred Hoyle, “The Universe: Past and Present Reflections” 12
Leviticus 19: 32-34 - Rise in the presence of the aged, show respect for the elderly and revere your God. I am the LORD. When an alien lives with you in your land, do not mistreat him. The alien living with you must be treated as one of your native-born. Love him as yourself. I am the LORD your God.
“The notion that the nested hierarchy of organisms is incompatible with creation is based, not on science, but on the unprovable theological assumption that if God created life He would do it in some other way. Distinct species division really is a poor way to create the world if you are tying to make evolution easily acceptable to the masses.”
"Biology is the study of complicated things that give the appearance of having been designed for a purpose." Richard Dawkins, "The Blind Watchmaker"
"Biology is the study of complicated things that give the appearance of having been designed for a purpose." Richard Dawkins, "The Blind Watchmaker"
Thursday, December 24, 2009
Not In Spite Of But Because
As we enter the time of year when we celebrate the most important event in the history of the universe; the coming of God through Jesus to reconcile the world to Himself, it stuck me again, how many people still think that God would not want to have anything to do with them.
Many people think that they can’t come to God because they aren’t good enough - yet. So they try and try and try some more to become acceptable. And here, all along they could have simply relaxed for God does not love us in spite of our brokenness but because of our broken souls.
When we bring our brokenness to our Creator, when we cast our anxieties and failures onto Him, Jesus sees it as an offering. In return, Jesus freely gives to us forgiveness, grace, mercy, healing, restoration and love - God’s love, the best love in the whole universe.
Everything that we need to survive this life and cannot get on our own, God gives to us not in spite of but because of His loving desire to step into the messy and broken places of our live, so that He can heal us and bring us safely home.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
Many people think that they can’t come to God because they aren’t good enough - yet. So they try and try and try some more to become acceptable. And here, all along they could have simply relaxed for God does not love us in spite of our brokenness but because of our broken souls.
When we bring our brokenness to our Creator, when we cast our anxieties and failures onto Him, Jesus sees it as an offering. In return, Jesus freely gives to us forgiveness, grace, mercy, healing, restoration and love - God’s love, the best love in the whole universe.
Everything that we need to survive this life and cannot get on our own, God gives to us not in spite of but because of His loving desire to step into the messy and broken places of our live, so that He can heal us and bring us safely home.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
Blessed are the Poor in Spirit
I remember when I hated working with depressed clients. I’d usually give their file to one of the other counsellors. Why? In short, clients with depression don’t get better - at least not for a long, long time. Oh, they change alright, but better? Mmm, that’s not a word that I would have used - not back then.
I liked working with clients who in 6 or 10 sessions were on their way and would likely not return.
And then something happened.
I’d lived 46 years with crippling arthritis. The drug patches and other opiates barely touched the pain. My wife helped me into and out of bed. She’d help me get dressed and undressed. I was running an Out Patient Counselling Clinic with all the associated staffing and client issues. 12 hour days and 6 day weeks were the norm. And then - I simply couldn’t do it any more. I had to quit. I’d never been defeated by anything before. I’d been roaring through life at a furious pace, overcoming all challenges. And then - I had to quit. I had to give up. I had to admit defeat.
You know when you meet someone you’re asked, “So what do you do?”
Of course you know.
I was a Christian. I didn’t define my life by who I was or what I did. My identity was in Christ alone. “Oh God I’m sorry for how dishonest I was with myself.”
“So what do you do?”
Yes indeed. What did I do. “Ah, I don’t do anything. I’m a man who does nothing.”
My own depression arrived during the early morning hours. I rose before anyone else and wondered from room to room in the house just trying to not cry. Don’t forget, I’ve been trained in treating people with depression. I’ve got a Graduate Degree worth of training in how to work with the mentally ill. I’d listened to hundreds and hundreds of stories from clients with depression. I knew what it was like to struggle with depression. And then I got my own. “Ohhhh, so THIS is what they’ve been talking about.”
“Blessed are the poor in Spirit for theirs is the kingdom of heaven” Matthew 5:3
“The Lord is close to the brokenhearted and saves those who are crushed in spirit” Psalm 34:18
Depending on where you’re at in your walk with God, you will either know of people who were or are crushed to the point of wondering if God really is a God of love, and you’re thinking, “How could anyone question the ways of God, or His love for them?”
OR
You will be or have been one of those people who have been crushed to the point where you wondered or still wonder, “Who is this God whose love for me once seemed so certain?”
The first group sing rousing songs of victory around the fire at camp.
Those in the latter group remember how it felt when they too sang those songs.
It’s been over ten years now since my depression arrived. I’m off meds and honestly? I’m symptom free. I hope however that I never forget.
And for what it’s worth? I love working with people who are struggling with depression. In fact, they’re my favourites. We may not always get better, but we are changed - fundamentally and forever.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
=========
I liked working with clients who in 6 or 10 sessions were on their way and would likely not return.
And then something happened.
I’d lived 46 years with crippling arthritis. The drug patches and other opiates barely touched the pain. My wife helped me into and out of bed. She’d help me get dressed and undressed. I was running an Out Patient Counselling Clinic with all the associated staffing and client issues. 12 hour days and 6 day weeks were the norm. And then - I simply couldn’t do it any more. I had to quit. I’d never been defeated by anything before. I’d been roaring through life at a furious pace, overcoming all challenges. And then - I had to quit. I had to give up. I had to admit defeat.
You know when you meet someone you’re asked, “So what do you do?”
Of course you know.
I was a Christian. I didn’t define my life by who I was or what I did. My identity was in Christ alone. “Oh God I’m sorry for how dishonest I was with myself.”
“So what do you do?”
Yes indeed. What did I do. “Ah, I don’t do anything. I’m a man who does nothing.”
My own depression arrived during the early morning hours. I rose before anyone else and wondered from room to room in the house just trying to not cry. Don’t forget, I’ve been trained in treating people with depression. I’ve got a Graduate Degree worth of training in how to work with the mentally ill. I’d listened to hundreds and hundreds of stories from clients with depression. I knew what it was like to struggle with depression. And then I got my own. “Ohhhh, so THIS is what they’ve been talking about.”
“Blessed are the poor in Spirit for theirs is the kingdom of heaven” Matthew 5:3
“The Lord is close to the brokenhearted and saves those who are crushed in spirit” Psalm 34:18
Depending on where you’re at in your walk with God, you will either know of people who were or are crushed to the point of wondering if God really is a God of love, and you’re thinking, “How could anyone question the ways of God, or His love for them?”
OR
You will be or have been one of those people who have been crushed to the point where you wondered or still wonder, “Who is this God whose love for me once seemed so certain?”
The first group sing rousing songs of victory around the fire at camp.
Those in the latter group remember how it felt when they too sang those songs.
It’s been over ten years now since my depression arrived. I’m off meds and honestly? I’m symptom free. I hope however that I never forget.
And for what it’s worth? I love working with people who are struggling with depression. In fact, they’re my favourites. We may not always get better, but we are changed - fundamentally and forever.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
=========
Wednesday, December 23, 2009
Blessed are the Meek
"Blessed are the Meek for they will inherit the earth." Matthew 5:5.
Have you realised that’s it’s ok to be a nothing? Paul said at one point, “Notice brothers that many of you who have been called are nobodies according to the world’s standards”
We don’t need a high education to be ok
We don’t need to make a lot of money to be ok
We don’t need to be better looking than most to be ok
We don’t even need to be in a romantic relationship to be ok
In fact, accepting our nothingness is a prerequisite for our journey to heaven. There is nothing we can do, nothing we can say, no one we can be to make ourselves worthy of forgiveness.
So relax. Enjoy your life because there is a God and He loves you. Everything that belongs to God belongs to His children. We don’t need to wait for heaven. We can have a healed, intimate and forgiven relationship with our Creator now. The only requirement? Just be yourself. Don’t pretend to be more or better than you are. Don’t pretend that you don’t need God in order to be a good person.
“A devout life does bring wealth, but it’s the rich simplicity of being yourself before God.” 1st Timothy 6:6
Have you realised that’s it’s ok to be a nothing? Paul said at one point, “Notice brothers that many of you who have been called are nobodies according to the world’s standards”
We don’t need a high education to be ok
We don’t need to make a lot of money to be ok
We don’t need to be better looking than most to be ok
We don’t even need to be in a romantic relationship to be ok
In fact, accepting our nothingness is a prerequisite for our journey to heaven. There is nothing we can do, nothing we can say, no one we can be to make ourselves worthy of forgiveness.
So relax. Enjoy your life because there is a God and He loves you. Everything that belongs to God belongs to His children. We don’t need to wait for heaven. We can have a healed, intimate and forgiven relationship with our Creator now. The only requirement? Just be yourself. Don’t pretend to be more or better than you are. Don’t pretend that you don’t need God in order to be a good person.
“A devout life does bring wealth, but it’s the rich simplicity of being yourself before God.” 1st Timothy 6:6
Know what that means?
Scientists tell us that the universe is flat. Do you know what that means?
Do you know what it would take to change it to something other than flat?
=============
Do you know what it would take to change it to something other than flat?
=============
Life Is Funny That Way
I can’t remember who it was but some guy commented on how adoption just wouldn’t be something that he could do.
Me neither.
My wife and I didn’t become Christians until 5 - 6 years into our marriage. Like many non-believers, I didn’t want to have ANY children (who could bring a kid into this rotten world ya-da ya-da). My real reason was I didn’t want to have other people take chunks of my life away from me - i.e., I was profoundly selfish.
Well, life has a way of changing.
As I could see one of these changes coming down the road, and no way to avoid it (not if I wanted to be able to look at myself in the mirror) I remember sitting out in the backyard and saying to God, “Father, if you want me to take these children, I need you to change me because my attitude stinks.”
In the blink of an eye it was done.
Atheists will say this was some psychological manipulation. I say it wasn’t. I know psychological manipulation. Psychological manipulation requires time and effort. It requires work to challenge our "wrong" thoughts and replace them with "correct" thoughts. I’ve used psychological manipulation and taught it to many hundreds if not over a thousand people before that incident and since. I know what it looks like, sounds like, feels like. This was something completely different.
In the blink of an eye my attitude went from practically everything negative to anticipation, joy, excitement and something I can’t quite explain. I’m not one to put any credence in feelings. I gag when Christians wait for a sense of peace in decision making. Some of the most important and correct decisions we will ever make will involve anything and everything except a sense of peace. In my counselling I’m prone to advise people to avoid making any decisions based on feelings of peace or otherwise. Our feelings lie and they lie frequently.
But this - well - like I said, this was different and my life has never been better ever since. At one point I didn’t want any kids and now I’m going to wind up raising seven of them. And I’m loving it.
Life is funny that way.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas
Me neither.
My wife and I didn’t become Christians until 5 - 6 years into our marriage. Like many non-believers, I didn’t want to have ANY children (who could bring a kid into this rotten world ya-da ya-da). My real reason was I didn’t want to have other people take chunks of my life away from me - i.e., I was profoundly selfish.
Well, life has a way of changing.
As I could see one of these changes coming down the road, and no way to avoid it (not if I wanted to be able to look at myself in the mirror) I remember sitting out in the backyard and saying to God, “Father, if you want me to take these children, I need you to change me because my attitude stinks.”
In the blink of an eye it was done.
Atheists will say this was some psychological manipulation. I say it wasn’t. I know psychological manipulation. Psychological manipulation requires time and effort. It requires work to challenge our "wrong" thoughts and replace them with "correct" thoughts. I’ve used psychological manipulation and taught it to many hundreds if not over a thousand people before that incident and since. I know what it looks like, sounds like, feels like. This was something completely different.
In the blink of an eye my attitude went from practically everything negative to anticipation, joy, excitement and something I can’t quite explain. I’m not one to put any credence in feelings. I gag when Christians wait for a sense of peace in decision making. Some of the most important and correct decisions we will ever make will involve anything and everything except a sense of peace. In my counselling I’m prone to advise people to avoid making any decisions based on feelings of peace or otherwise. Our feelings lie and they lie frequently.
But this - well - like I said, this was different and my life has never been better ever since. At one point I didn’t want any kids and now I’m going to wind up raising seven of them. And I’m loving it.
Life is funny that way.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas
Tuesday, December 22, 2009
Do You Know About the Thin Places?
When Jesus said, “Blessed are the poor in spirit, for theirs is the Kingdom of Heaven.” did you know that blessed, as it was used then meant happy, fortunate, favoured?
That’s a very confusing concept for those who believe that happiness is dependent on circumstance.
“Favoured are those who are poor in spirit because that is when the kingdom of Heaven is very, very close to them.”
Some of you will know what I’m talking about when I mention the Thin Places - The places in our day, our life when we can almost touch the other side. The thin places are those times when God’s presence is so palpable, so thick that you know beyond all doubt that there is more to life than what meets the eye. I first experienced this when one of our children died. The air was so thick with the presence of God, I wouldn’t have been surprised to see a depression in the couch cushion where His presence rested. The grief and the comfort were so intertwined that they really couldn’t have been separated.
Fortunate are the broken hearted for they will see God.
Because of His time on earth in the person of Jesus, God gets it. He knows our loneliness, our emptiness and fear, our desperation and rage. From His understanding comes His compassion and blessing.
Happy are those who are desperate for God is near to them.
Atheists rage like petulant children at the sorrows of life. While the entrance of sorrow into human life was our decision, sorrow and evil do not have the last word. God draws us to Himself through life’s pain and sorrow.
Blessed are the poor in spirit for theirs is the kingdom of heaven.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas
That’s a very confusing concept for those who believe that happiness is dependent on circumstance.
“Favoured are those who are poor in spirit because that is when the kingdom of Heaven is very, very close to them.”
Some of you will know what I’m talking about when I mention the Thin Places - The places in our day, our life when we can almost touch the other side. The thin places are those times when God’s presence is so palpable, so thick that you know beyond all doubt that there is more to life than what meets the eye. I first experienced this when one of our children died. The air was so thick with the presence of God, I wouldn’t have been surprised to see a depression in the couch cushion where His presence rested. The grief and the comfort were so intertwined that they really couldn’t have been separated.
Fortunate are the broken hearted for they will see God.
Because of His time on earth in the person of Jesus, God gets it. He knows our loneliness, our emptiness and fear, our desperation and rage. From His understanding comes His compassion and blessing.
Happy are those who are desperate for God is near to them.
Atheists rage like petulant children at the sorrows of life. While the entrance of sorrow into human life was our decision, sorrow and evil do not have the last word. God draws us to Himself through life’s pain and sorrow.
Blessed are the poor in spirit for theirs is the kingdom of heaven.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas
You Tube atheists
Remember all the atheist historians on You Tube who've told us that Nazareth never existed? And Jesus never existed and and and . . .
http://www.cbc.ca/technology/story/2009/12/22/tech-archeology-nazareth.html
http://www.cbc.ca/technology/story/2009/12/22/tech-archeology-nazareth.html
Blessed Are Those Who Mourn
I think it was C. S. Lewis who said, “It’s better to limp along the right road than to race along the wrong road.”
Jesus said, “Blessed (happy, favoured, fortunate) are those who mourn for they will be comforted.” Matthew 5:4.
I remind any and all of the people with whom I work that there is not a single pew in our congregation that is not filled with those who are struggling. A marriage has or is ending. A child is making self-destructive choices. A loved one has died. An addiction is reaching the point where it can’t be hidden any more. There are many, many reasons to mourn. Life is filled to the brim with opportunities to grieve, to mourn and to be comforted.
When our child died, for two weeks we were hardly ever alone. From about an hour after breakfast to about an hour before we turned in for the night, we were in the presence of friends. To this day, I don’t know if it was organised. It must have been, for as one friend got up to leave, another would appear. It wasn’t intrusive. Many times we went on with what needed to be done while they were simply there; talking to the other kids or reading a magazine at the kitchen table. On a couple occasions we’d say good bye to a friend and as I walked past the kitchen window, another friend was sitting down on the deck with a book. If I hadn’t greeted them, I suspect that not a word would have been said. They were just - there. For two weeks, comforters were present. It brings tears to my eyes right now just remembering the goodness and the mercy.
It is terribly difficult for those who have been led to believe that if only they would commit their lives to Jesus the Christ, all would go well in their lives.
Now, to be fair, much of the suffering that we experience comes from our own crappy choices. On the other hand, through no fault of our own, we get abandoned and ambushed by people and by life itself. Dreams turn to nightmares. What once seemed like answers now seem completely inadequate. Our pride turns to shame and embarrassment. Confidence turns to confusion and despair. Friendships have turned to hurtful gossip. Smiles have turned to tears. Numb or angry, the God we trusted is using a means of changing us that seems entirely wrong. Afraid to try again. Afraid to trust. Afraid that there’s much more hardship to come. Afraid to hope and afraid to love.
Fortunate? Favoured? Happy? Mmm, not so much. And yet it IS good. God does - something - something. And the something that He does for those willing to observe leads to thoughts like this one from the apostle Paul, “Therefore I rejoice in my suffering, in my infirmities, in weakness and insults.”
This is one of the aspects of walking through life with our Creator that is most confusing. Richard Dawkins said that he is “bewildered” by Christians because suffering seems to make them stronger. The comfort of God in the midst of our mourning is a strange and wonderful thing. No matter the loss that you’ve experienced, the hurt that you encounter, the confusion and despair that seems to come in wave after wave, the love and mercy of our Lord and Saviour is greater than it all. My prayer is that you'll let Him love you this Christmas season and forever.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
Jesus said, “Blessed (happy, favoured, fortunate) are those who mourn for they will be comforted.” Matthew 5:4.
I remind any and all of the people with whom I work that there is not a single pew in our congregation that is not filled with those who are struggling. A marriage has or is ending. A child is making self-destructive choices. A loved one has died. An addiction is reaching the point where it can’t be hidden any more. There are many, many reasons to mourn. Life is filled to the brim with opportunities to grieve, to mourn and to be comforted.
When our child died, for two weeks we were hardly ever alone. From about an hour after breakfast to about an hour before we turned in for the night, we were in the presence of friends. To this day, I don’t know if it was organised. It must have been, for as one friend got up to leave, another would appear. It wasn’t intrusive. Many times we went on with what needed to be done while they were simply there; talking to the other kids or reading a magazine at the kitchen table. On a couple occasions we’d say good bye to a friend and as I walked past the kitchen window, another friend was sitting down on the deck with a book. If I hadn’t greeted them, I suspect that not a word would have been said. They were just - there. For two weeks, comforters were present. It brings tears to my eyes right now just remembering the goodness and the mercy.
It is terribly difficult for those who have been led to believe that if only they would commit their lives to Jesus the Christ, all would go well in their lives.
Now, to be fair, much of the suffering that we experience comes from our own crappy choices. On the other hand, through no fault of our own, we get abandoned and ambushed by people and by life itself. Dreams turn to nightmares. What once seemed like answers now seem completely inadequate. Our pride turns to shame and embarrassment. Confidence turns to confusion and despair. Friendships have turned to hurtful gossip. Smiles have turned to tears. Numb or angry, the God we trusted is using a means of changing us that seems entirely wrong. Afraid to try again. Afraid to trust. Afraid that there’s much more hardship to come. Afraid to hope and afraid to love.
Fortunate? Favoured? Happy? Mmm, not so much. And yet it IS good. God does - something - something. And the something that He does for those willing to observe leads to thoughts like this one from the apostle Paul, “Therefore I rejoice in my suffering, in my infirmities, in weakness and insults.”
This is one of the aspects of walking through life with our Creator that is most confusing. Richard Dawkins said that he is “bewildered” by Christians because suffering seems to make them stronger. The comfort of God in the midst of our mourning is a strange and wonderful thing. No matter the loss that you’ve experienced, the hurt that you encounter, the confusion and despair that seems to come in wave after wave, the love and mercy of our Lord and Saviour is greater than it all. My prayer is that you'll let Him love you this Christmas season and forever.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
Monday, December 21, 2009
Christianity
A Pastor once said, "Never trust a Christian who hasn’t been broken by life."
Same songs,
Same words,
Same prayers,
Same behaviours,
Same claims of victory.
For one person, it’s theory.
For the person who's been broken by life, it’s reality.
For one person, it’s the right thing to do.
For the person who's been broken by life, it’s the only thing to do.
One person has time for things religious
The one who’s been broken by life has time for you.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas
Same songs,
Same words,
Same prayers,
Same behaviours,
Same claims of victory.
For one person, it’s theory.
For the person who's been broken by life, it’s reality.
For one person, it’s the right thing to do.
For the person who's been broken by life, it’s the only thing to do.
One person has time for things religious
The one who’s been broken by life has time for you.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas
Losing My Religion
Many a person was raised in a home where s/he was told, “It is sufficient to know that God is supreme, a Being who issues His orders without the remotest regard to moral right; and if you question God’s authority you are in danger of blaspheming."
There is always a tendency in humans to produce an absolute authority. We then accept the authority of the Church (this is particularly true of Catholics), or of the Bible, or of a creed or statement of faith. And often we refuse to do any more thinking on the matter. In so doing we ignore the essential nature of Christianity which is based on a personal relationship with Jesus the Christ. Without this relationship we feel forced to perform “good works” based on responsibility or obligation.
Based on my faith in the redeeming work of Jesus I am saved. When God puts His Holy Spirit into me, He expects me to react on the basis of that relationship. I can evade it by dumping my responsibility on to a church or a book or a creed, forgetting what Jesus said, “Search the scriptures which testify of Me; and you will come to Me, that you might have life.”
The most effective way to understand the Scripture is not to accept them blindly, but to read then in the light of a personal, intimate and forgiven relationship with Jesus.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
There is always a tendency in humans to produce an absolute authority. We then accept the authority of the Church (this is particularly true of Catholics), or of the Bible, or of a creed or statement of faith. And often we refuse to do any more thinking on the matter. In so doing we ignore the essential nature of Christianity which is based on a personal relationship with Jesus the Christ. Without this relationship we feel forced to perform “good works” based on responsibility or obligation.
Based on my faith in the redeeming work of Jesus I am saved. When God puts His Holy Spirit into me, He expects me to react on the basis of that relationship. I can evade it by dumping my responsibility on to a church or a book or a creed, forgetting what Jesus said, “Search the scriptures which testify of Me; and you will come to Me, that you might have life.”
The most effective way to understand the Scripture is not to accept them blindly, but to read then in the light of a personal, intimate and forgiven relationship with Jesus.
Happy Holy Days - and may the comfort of His presence allow for you to experience a Merry and Joyous Christmas.
Friday, December 18, 2009
(((Sigh))) Disappointing
Several weeks ago Elise asked if it was possible for communication to take place between people who hold to such diametrically opposing views. Some said, Of course we can, but I think she’s right. All we do is throw words at each other.
I’ve pointed out a couple times that it doesn’t seem to be the information that I present that is the problem. No one for example has told me that the information in the post, “So, Correct Me” is wrong. It’s that “scientific” information that is coming from a Christian is not acceptable. This is especially true if that information requires atheists to question their deeply held convictions. If that’s not the reason for atheists ignoring scientifically correct information, then you tell me? What’s the reason for expressing your unexamined prejudice and thereby blocking yourself from open inquiry?
It’s not like methodological naturalism doesn’t refer to intelligent agents or use design detection on a regular basis on its own. Archaeologists, forensic scientists, cryptographers, and anthropologists infer past intelligence as cause all the time. Even astro biologists on the hunt for extraterrestrial intelligence have followed Sagan’s dictum that if we could find just one line of information, we have discovered proof of intelligence aside from our own.
Just one line of information.
That’s all it would take.
Place in front of atheists a volume of information equivalent to 1,000 sets of the encyclopaedia Britannica however and what do we get? “It’s just biological material, folks. There’s nothing to see here. Go on home.”
I was taken to task for saying that atheists restrict themselves to a narrow band, an unrealistically narrow band of evidence. I still think it’s true. I’m open to any explanation of what we observe. If supernatural gives the Best Evidence, so be it. If evidence for a naturalistic explanation points the way, then let’s follow it. Not so for atheists. They are committed to only what’s immediately in front of them. Because of that narrow band of awareness, my fear is that atheists are committing themselves to an unjustified and quite likely a false view of biological origins.
I mean, ask yourself. Is it not at least logically POSSIBLE that an intelligent, conscious, personal agent existed prior to the appearance of first life?
Is it not even possible?
And if it IS possible that an intelligent agent existed prior to the advent of biological life on earth then isn’t it also possible that the activity of this agent could be detected by some means of scientific detection? As stated, origins and historical science uses these methods on a regular basis. One method, “competing hypothesis” was used in this series.
Can you call yourself scientifically minded and live by the assertion that it’s absolutely impossible that any intelligence of any kind existed prior to biological life on earth?
And how can you say that with such certainty given the complete lack of supporting and verified evidence for biological abiogenesis? Oh sure, there’s Dawkins version of events but seriously, the number of people unhooking their wagon from his star is growing exponentially every day.
If you consider yourself a truth seeker regarding the origin of life on earth, you cannot limit this issue to the question, “Which methodologically natural hypothesis is most adequate?”
Rather, I should think the question would be, “What is the Best Evidence regarding the origin of the information that made possible the rise of first life on earth?”
We know that Chance is an extremely unlikely candidate. Have you ever asked yourself why the multi verse hypothesis was invented?
We know that Chemical necessity is an extremely unlikely candidate. Have you ever asked yourself why the multi verse hypothesis was invented?
We know that RNA replication is an extremely unlikely candidate. Have you ever asked yourself why the multi verse hypothesis was invented?
The multi verse hypothesis was invented because all of the above are extremely unlikely candidates. This is really sad, but the next best thing in the atheist’s quiver is an infinite number of universes where one of those universes had specified, formulated information arise by a means other than by an intelligent agent - "Hey! Just like ours did."
Setting aside this atheist origin of life mythology for a bit . . . Beyond knowing that the above are highly improbable, we also know that large amounts of specified complexity or formulated information are generated ONLY by Intelligent Agents. Just how committed do you have to be to a world-view to purposely ignore the evidence that’s looking you straight in the eye? (((Sigh))).
In fact I think it's possible that the atheist’s inability to comprehend what it is they are reading is one more piece of evidence for Creator God. Unless someone has been “made” intellectually deaf and blind, as some portions of Scripture suggest may be the case, no one can be so stupid as to not recognise the evidence for Creator God that has been placed before them.
The atheists that post here seem to be caught in a paradigm where only one type of evidence is acceptable, i.e., naturalism or materialism. What they don’t seem to realise is that when proposals that fit ONLY one type of competition, or proposals that fit ONLY into an artificially constrained competition (nothing beyond nature is allowed) then those examining those proposals cannot say that their theory is the best or the most true or the most causally adequate. It’s like holding a race to see who is the fastest runner in the world, but only white males from North America may compete.
Neither Chance, nor Predestination nor RNA replication are workable, but those are the only theories that atheists will allow themselves to choose from. How scientific is that?
If you really are a seeker of truth, then it would seem to me that ANYTHING that answers the question and is causally adequate should be examined. I mean, are you after an answer? Or are you after the right answer? Following the evidence regardless of where it leads is the only method that will take you closer to the truth. Rejecting hypothesis a priori because of their possible metaphysical outcomes seems to me just the opposite of the scientific method that atheists claim to hold so dear.
Judging by causal adequacy is a neutral criteria from a scientific AND a metaphysical point of view. Yet this more rational approach is simply not allowed by the rational, logical and reasonable atheists posting here.
Humans can be sooo disappointing!
I’ve pointed out a couple times that it doesn’t seem to be the information that I present that is the problem. No one for example has told me that the information in the post, “So, Correct Me” is wrong. It’s that “scientific” information that is coming from a Christian is not acceptable. This is especially true if that information requires atheists to question their deeply held convictions. If that’s not the reason for atheists ignoring scientifically correct information, then you tell me? What’s the reason for expressing your unexamined prejudice and thereby blocking yourself from open inquiry?
It’s not like methodological naturalism doesn’t refer to intelligent agents or use design detection on a regular basis on its own. Archaeologists, forensic scientists, cryptographers, and anthropologists infer past intelligence as cause all the time. Even astro biologists on the hunt for extraterrestrial intelligence have followed Sagan’s dictum that if we could find just one line of information, we have discovered proof of intelligence aside from our own.
Just one line of information.
That’s all it would take.
Place in front of atheists a volume of information equivalent to 1,000 sets of the encyclopaedia Britannica however and what do we get? “It’s just biological material, folks. There’s nothing to see here. Go on home.”
I was taken to task for saying that atheists restrict themselves to a narrow band, an unrealistically narrow band of evidence. I still think it’s true. I’m open to any explanation of what we observe. If supernatural gives the Best Evidence, so be it. If evidence for a naturalistic explanation points the way, then let’s follow it. Not so for atheists. They are committed to only what’s immediately in front of them. Because of that narrow band of awareness, my fear is that atheists are committing themselves to an unjustified and quite likely a false view of biological origins.
I mean, ask yourself. Is it not at least logically POSSIBLE that an intelligent, conscious, personal agent existed prior to the appearance of first life?
Is it not even possible?
And if it IS possible that an intelligent agent existed prior to the advent of biological life on earth then isn’t it also possible that the activity of this agent could be detected by some means of scientific detection? As stated, origins and historical science uses these methods on a regular basis. One method, “competing hypothesis” was used in this series.
Can you call yourself scientifically minded and live by the assertion that it’s absolutely impossible that any intelligence of any kind existed prior to biological life on earth?
And how can you say that with such certainty given the complete lack of supporting and verified evidence for biological abiogenesis? Oh sure, there’s Dawkins version of events but seriously, the number of people unhooking their wagon from his star is growing exponentially every day.
If you consider yourself a truth seeker regarding the origin of life on earth, you cannot limit this issue to the question, “Which methodologically natural hypothesis is most adequate?”
Rather, I should think the question would be, “What is the Best Evidence regarding the origin of the information that made possible the rise of first life on earth?”
We know that Chance is an extremely unlikely candidate. Have you ever asked yourself why the multi verse hypothesis was invented?
We know that Chemical necessity is an extremely unlikely candidate. Have you ever asked yourself why the multi verse hypothesis was invented?
We know that RNA replication is an extremely unlikely candidate. Have you ever asked yourself why the multi verse hypothesis was invented?
The multi verse hypothesis was invented because all of the above are extremely unlikely candidates. This is really sad, but the next best thing in the atheist’s quiver is an infinite number of universes where one of those universes had specified, formulated information arise by a means other than by an intelligent agent - "Hey! Just like ours did."
Setting aside this atheist origin of life mythology for a bit . . . Beyond knowing that the above are highly improbable, we also know that large amounts of specified complexity or formulated information are generated ONLY by Intelligent Agents. Just how committed do you have to be to a world-view to purposely ignore the evidence that’s looking you straight in the eye? (((Sigh))).
In fact I think it's possible that the atheist’s inability to comprehend what it is they are reading is one more piece of evidence for Creator God. Unless someone has been “made” intellectually deaf and blind, as some portions of Scripture suggest may be the case, no one can be so stupid as to not recognise the evidence for Creator God that has been placed before them.
The atheists that post here seem to be caught in a paradigm where only one type of evidence is acceptable, i.e., naturalism or materialism. What they don’t seem to realise is that when proposals that fit ONLY one type of competition, or proposals that fit ONLY into an artificially constrained competition (nothing beyond nature is allowed) then those examining those proposals cannot say that their theory is the best or the most true or the most causally adequate. It’s like holding a race to see who is the fastest runner in the world, but only white males from North America may compete.
Neither Chance, nor Predestination nor RNA replication are workable, but those are the only theories that atheists will allow themselves to choose from. How scientific is that?
If you really are a seeker of truth, then it would seem to me that ANYTHING that answers the question and is causally adequate should be examined. I mean, are you after an answer? Or are you after the right answer? Following the evidence regardless of where it leads is the only method that will take you closer to the truth. Rejecting hypothesis a priori because of their possible metaphysical outcomes seems to me just the opposite of the scientific method that atheists claim to hold so dear.
Judging by causal adequacy is a neutral criteria from a scientific AND a metaphysical point of view. Yet this more rational approach is simply not allowed by the rational, logical and reasonable atheists posting here.
Humans can be sooo disappointing!
Got Junk?
Atheists tell us that one way of knowing whether what you are doing is “science” is, “Is it testable?” Does your method of inquiry include making a prediction and then seeing if your hypothesis will fulfill that prediction. For those who believe that only science can reveal truth, this is a VERY important step.
Intelligent Design theory follows this route. Before I get to that, let me point out a couple other areas that the scientific concept of ID covers.
. The case for ID is based on empirical evidence. I’ve given you almost two weeks of empirical evidence beginning with the first post called, “Nothing Did It.” This same post gives an example of the digital code that is found in every cell of every living object. As well, ID examines irreducible complexity of molecular machines as well as the circuits in all living cells. ID examines the pattern and order of appearance of groups of organisms in the fossil record. ID investigates the fine tuning of the universe and the constants and qualities and laws of physics. Not only the information storage capacity of DNA but the decoding and transmitting system of Proteins is examined in ID. Intelligent Design is, at it’s base, founded on the commonly accepted observations of the world around us.
For the most part, the majority of the posts in this series have been an example of one means of testing in ID. That is, testing the causal adequacy of competing hypothesis. Darwin himself used this method. Oooo. As a result, we saw, or at least those willing to see, found that ID explains better than Chance, Chemical Necessity and RNA reproduction the interdependent information processing system that is found in each and every living cell.
Acceptance or rejection of competing theories is made based upon what we know from experience. ID is not just a known cause of large quantities of specified complexity. ID is the ONLY known cause of large quantities of specified complexity. That means ID theory fulfills two important scientific criteria; that of causal adequacy (It can do the job) and causal existence (It has done and is doing the job).
Back to predictions. Let’s compare material evolutionary prediction and ID prediction on one important area. That area is junk DNA. I doubt that’s a new term to anyone commenting here so I won’t go into a lengthy explanation. In short, however, junk DNA is DNA that doesn’t code for proteins, as does the DNA we’ve all come to know and love.
As you might guess, those who believe that cells have arisen by trial and error predict that there should be a lot of, well, leftover junk. This is useless stuff that a trillion years or so ago would have been a brand new idea and as good as cells got back then.
Michael Shermer says, “Rather than being intelligently designed, the human genome looks more and more like a mosaic of mutations, fragmented copies, borrowed sequences, and discarded strings of DNA that were jerry-built over millions of years of evolution.”
“Why Darwin Matters” 75
“The critics of evolution like to say that the complexity of the genome makes it clear that it was designed. But there’s a problem with that analysis, and it’s a serious one. The problem is the genome itself; it’s not perfect. In fact, it’s riddled with useless information, mistakes, and broken genes. Molecular biologists actually call some of these regions ‘gene deserts,’ reflecting the barren nature.”
Ken Miller, “Only a Theory” 96-97
“If you were designing the genomes of organisms, you would not fill them up with junk.”
Philip Kitcher, “Living with Darwin” 57
There’s more of this kind of thing, but you get the idea. Junk - waste products and such are exactly what natural selection predicts with regard to the genome.
Not so with Intelligent Design. ID predicts that most of the non coding sequences in any genome should perform some biological function. That’s not to say that there won’t be any broken or degraded DNA. Remember, Intelligent Design does not deny evolution or natural selection. What ID predicts, however, is that functional DNA should far out number nonfunctional DNA.
. Evolution of the first cell predicts a lot of junk DNA.
. ID of the first cell predicts a minimal amount of useless DNA.
What is now known is that the non coding DNA, formerly thought to be junk by evolutionists, actually performs a massive amount of important biological functions - just as ID predicts.
Remember this line, from the atheist Keith? “If we [atheists] find evidence to show something we thought was wrong, we don't hold on to the original belief like leach.” Ya, right.
Just as Stanley Miller’s faux experiment re: amino acids forming in early earth’s reducing atmosphere remained on the books long after it was known to be wrong, Shermer, Miller (Kenneth) and Kitcher have continued to spread the predictions and the false “confirming findings” re: junk DNA long after it’s been known that their predictions and their theory was wrong. How wrong are they?
Non coding or junk DNA:
. Regulates DNA replication
. Marks sites for programmed rearrangements of genetic material
. Regulates transcriptions
. Controls the interactions of chromosomes with the nuclear membrane
. Influences the proper folding and maintenance of chromosomes
. Controls RNA processing, editing and splicing
. Modulate translation
. Regulates embryological development
. Repairs DNA, and
. Aids in immunodefence
Meyers, 407
This is a long, long way from being junk as natural theories of evolution predicted.
It’s bang on as ID predicted.
Intelligent Design theory follows this route. Before I get to that, let me point out a couple other areas that the scientific concept of ID covers.
. The case for ID is based on empirical evidence. I’ve given you almost two weeks of empirical evidence beginning with the first post called, “Nothing Did It.” This same post gives an example of the digital code that is found in every cell of every living object. As well, ID examines irreducible complexity of molecular machines as well as the circuits in all living cells. ID examines the pattern and order of appearance of groups of organisms in the fossil record. ID investigates the fine tuning of the universe and the constants and qualities and laws of physics. Not only the information storage capacity of DNA but the decoding and transmitting system of Proteins is examined in ID. Intelligent Design is, at it’s base, founded on the commonly accepted observations of the world around us.
For the most part, the majority of the posts in this series have been an example of one means of testing in ID. That is, testing the causal adequacy of competing hypothesis. Darwin himself used this method. Oooo. As a result, we saw, or at least those willing to see, found that ID explains better than Chance, Chemical Necessity and RNA reproduction the interdependent information processing system that is found in each and every living cell.
Acceptance or rejection of competing theories is made based upon what we know from experience. ID is not just a known cause of large quantities of specified complexity. ID is the ONLY known cause of large quantities of specified complexity. That means ID theory fulfills two important scientific criteria; that of causal adequacy (It can do the job) and causal existence (It has done and is doing the job).
Back to predictions. Let’s compare material evolutionary prediction and ID prediction on one important area. That area is junk DNA. I doubt that’s a new term to anyone commenting here so I won’t go into a lengthy explanation. In short, however, junk DNA is DNA that doesn’t code for proteins, as does the DNA we’ve all come to know and love.
As you might guess, those who believe that cells have arisen by trial and error predict that there should be a lot of, well, leftover junk. This is useless stuff that a trillion years or so ago would have been a brand new idea and as good as cells got back then.
Michael Shermer says, “Rather than being intelligently designed, the human genome looks more and more like a mosaic of mutations, fragmented copies, borrowed sequences, and discarded strings of DNA that were jerry-built over millions of years of evolution.”
“Why Darwin Matters” 75
“The critics of evolution like to say that the complexity of the genome makes it clear that it was designed. But there’s a problem with that analysis, and it’s a serious one. The problem is the genome itself; it’s not perfect. In fact, it’s riddled with useless information, mistakes, and broken genes. Molecular biologists actually call some of these regions ‘gene deserts,’ reflecting the barren nature.”
Ken Miller, “Only a Theory” 96-97
“If you were designing the genomes of organisms, you would not fill them up with junk.”
Philip Kitcher, “Living with Darwin” 57
There’s more of this kind of thing, but you get the idea. Junk - waste products and such are exactly what natural selection predicts with regard to the genome.
Not so with Intelligent Design. ID predicts that most of the non coding sequences in any genome should perform some biological function. That’s not to say that there won’t be any broken or degraded DNA. Remember, Intelligent Design does not deny evolution or natural selection. What ID predicts, however, is that functional DNA should far out number nonfunctional DNA.
. Evolution of the first cell predicts a lot of junk DNA.
. ID of the first cell predicts a minimal amount of useless DNA.
What is now known is that the non coding DNA, formerly thought to be junk by evolutionists, actually performs a massive amount of important biological functions - just as ID predicts.
Remember this line, from the atheist Keith? “If we [atheists] find evidence to show something we thought was wrong, we don't hold on to the original belief like leach.” Ya, right.
Just as Stanley Miller’s faux experiment re: amino acids forming in early earth’s reducing atmosphere remained on the books long after it was known to be wrong, Shermer, Miller (Kenneth) and Kitcher have continued to spread the predictions and the false “confirming findings” re: junk DNA long after it’s been known that their predictions and their theory was wrong. How wrong are they?
Non coding or junk DNA:
. Regulates DNA replication
. Marks sites for programmed rearrangements of genetic material
. Regulates transcriptions
. Controls the interactions of chromosomes with the nuclear membrane
. Influences the proper folding and maintenance of chromosomes
. Controls RNA processing, editing and splicing
. Modulate translation
. Regulates embryological development
. Repairs DNA, and
. Aids in immunodefence
Meyers, 407
This is a long, long way from being junk as natural theories of evolution predicted.
It’s bang on as ID predicted.
Thursday, December 17, 2009
Still Stupid
I might be wrong, but I think it was Christ Follower No Longer but Still Stupid, who made some comments about, since we can’t observe God then He obviously :-) can’t be the answer to "Where did the information come from that made first life possible?”
That might sound like the dumbest thing ever said, but Still Stupid is not alone. I've heard that from many atheists and I think it was Michael Ruse who said that Intelligent Design can’t be considered a scientific concept because “it invokes an unobservable entity.”
It seems that many atheists live under the delusion that science deals only with what the senses can detect. Molecular biologist Fred Grinnell even said, “If something can’t be measured, or counted, or photographed, it can’t be science.”
“Radical Intersubjectivity” 29
Obviously, Still Stupid isn’t alone. But is he correct?
As I’ve stated, Intelligent Design “infers” an Intelligent Agent as being responsible for the digital information that we find in DNA. When atheists read that they scoff as though inferring a past unobservable cause from present evidence is a totally foreign concept. Not!
. Theories of chemical evolution refer to events that took place millions if not billions of years ago. No one saw them then and certainly no one sees them now.
. Biologists of the Darwinian school refer to creative processes too slow to see and too fast to be found in the fossil record. Doubt or even question this unobservable “process” and feel the wrath of this self-righteous and insecure group.
. The tree of life “contains” many transitional forms that are not and have not been observed by anyone. Yet they are affirmed as a given to explain what we observe as true today.
How is this different from inferring an Intelligent Agent that is the ONLY known explanation for the specified complexity we observe today? Neither the working of past chemical evolution nor the past working of an Intelligent Agent are observable.
Christians can accept that both areas of evidence are possible. Atheists, who have a priori restricted themselves to a very unrealistic and narrow band of acceptable evidence can accept only one possibility. Neither Intelligent Design nor any natural theory of origins, certainly not the ones I’ve talked about in this series are observable and therefore neither qualifies as a potential answer according to Still Stupid.
In reality science often refers to the unobservable to explain the events we observe. If atheists want to use “unobservable” as a criteria for acceptability re: explanations, They're going to refute their own theories. Physical forces, gravitational fields, biomolecular structures, and sub atomic particles - none of these are observable entities but they are inferred from observable evidence.
As you go through life, you'll find that those who hold to a double standard are always driven by a single agenda.
That might sound like the dumbest thing ever said, but Still Stupid is not alone. I've heard that from many atheists and I think it was Michael Ruse who said that Intelligent Design can’t be considered a scientific concept because “it invokes an unobservable entity.”
It seems that many atheists live under the delusion that science deals only with what the senses can detect. Molecular biologist Fred Grinnell even said, “If something can’t be measured, or counted, or photographed, it can’t be science.”
“Radical Intersubjectivity” 29
Obviously, Still Stupid isn’t alone. But is he correct?
As I’ve stated, Intelligent Design “infers” an Intelligent Agent as being responsible for the digital information that we find in DNA. When atheists read that they scoff as though inferring a past unobservable cause from present evidence is a totally foreign concept. Not!
. Theories of chemical evolution refer to events that took place millions if not billions of years ago. No one saw them then and certainly no one sees them now.
. Biologists of the Darwinian school refer to creative processes too slow to see and too fast to be found in the fossil record. Doubt or even question this unobservable “process” and feel the wrath of this self-righteous and insecure group.
. The tree of life “contains” many transitional forms that are not and have not been observed by anyone. Yet they are affirmed as a given to explain what we observe as true today.
How is this different from inferring an Intelligent Agent that is the ONLY known explanation for the specified complexity we observe today? Neither the working of past chemical evolution nor the past working of an Intelligent Agent are observable.
Christians can accept that both areas of evidence are possible. Atheists, who have a priori restricted themselves to a very unrealistic and narrow band of acceptable evidence can accept only one possibility. Neither Intelligent Design nor any natural theory of origins, certainly not the ones I’ve talked about in this series are observable and therefore neither qualifies as a potential answer according to Still Stupid.
In reality science often refers to the unobservable to explain the events we observe. If atheists want to use “unobservable” as a criteria for acceptability re: explanations, They're going to refute their own theories. Physical forces, gravitational fields, biomolecular structures, and sub atomic particles - none of these are observable entities but they are inferred from observable evidence.
As you go through life, you'll find that those who hold to a double standard are always driven by a single agenda.
Huh?
Here's what the dull of mind and slow of thought say after a week and a half spent talking about information, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”
I say, “I’m defining information between Ginx and I as, “The communication or reception of knowledge or intelligence.” And I`m defining information found in biological organisms as , “the attribute inherent in, and communicated by alternative sequences or arrangements of something that produces specific effects.” Both definitions are from Webster’s English Dictionary.
Atheists say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”
I say, “Information as it is defined in the second definition does not require a conscious recipient of a message; because it is referring to a sequence of characters that produces a specific effect.
Information as it is defined in the first definition means that the only thing preceding our information exchanges were our thoughts which in turn found their origin in our intelligence, our intellect, our mind.
Atheists say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”
I say:
01010111011010000011001011011100010000001101001011
01110001000000111010001101000011001010010000001000
00110110111011101010111001000111001101100101001000
00011011110110011000100000011010000111010101101101
011000010110111000100000011001010111011001100101
011011100111010001110011001000000110100101110100
Know what that says in the American Standard Code for Information Interchange, i.e., Binary Code?
ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGG
CCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCC
GCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCG
CCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAG
GCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC
How about this code? Do you think it took intelligent thought to construct this information in a manner that would allow for life to begin to exist? This is part of the sequence of genetic assembly instructions for constructing an RNA polymerase. This “machine code” is critical for information processing in a living cell. Without it being exactly as is - no working cell.
Watson and Crick, “Molecular Biology of the Gene,” 1:704
Humans of course are used to information.
We create information via our thoughts.
We pass on that information to others, and
We take in information that was created by other people’s thoughts.
We do this all day long.
“The technology of information theory and coding theory has been in place in biology for at least 3.85 billion years.”
“River out of Eden”, 17
As even Richard Dawkins says, “The machine code of the genes is uncannily computer-like.
“DNA is like a computer program but far, far more advanced than any software ever created.”
All of human experience confirms that information comes from thoughts and thoughts come from intelligence.
I show atheists that DNA forms part of a communication channel that can be analysed using information theory.
I show atheists that DNA molecules are highly and quantifiably complex.
I show atheists that the arrangement of bases in DNA and amino acids in proteins carry not just complexity but SPECIFIED complexity.
I show atheists that the information in DNA contains alternative sequences or arrangements that produce a specific effect.
I show atheists that DNA displays a functional specificity that goes WAY beyond the mathematical formalism of information theory.
Whether atheists know it or not (not) this specified complexity is found no where else in nature. Only in DNA, RNA and proteins do we find this information in a specified complex formulation.
Information scientist Hubert Yockey, “The genetic code is constructed to confront and solve the problems of communication and recording by the same principles found in modern communication and computer codes.”
DNA is amazingly complex information. But information is useless if there is no way to retrieve, process, translate and use that information for the PURPOSE intended.
Information is an entity in and of itself? Information is not a by-product, or some sort of residue from chemical reactions.
Information is as real as matter and energy. We own it, buy it, sell it, store it, transmit it, encode it and decode it.
Information comes from a thought that is based in an intelligent mind. The intelligent mind forms / invents a code, be it binary code, or letters in an alphabet, or base chemicals, A,C,G,T and the intelligent mind uses that code to convey the message / instructions to the intended recipient.
This - I love you. I'll meet you after work. - is specified complexity.
Not only does it use parts of a very complex code. It uses the complex code in a formulated and specified manner to convey a message or instructions.
Our cells don’t just contain a place to store vast amounts of information. They contain a code, a specified code (information) for translating that code AND they contain a means, a processing system which allows the construction of proteins.
The main question facing scientists today when trying to explain the origin of first life is: “How did the sequence-specific digital information necessary to building the first cell arise?”
Kuppers, “Information and the Origin of Life,” 170-172.
The reduction of uncertainty takes place with the transmission of information. The more improbable the event the more information that is conveyed.
If forces of potential energy determined the arrangement of the bases, the code-like character of the molecule would be effaced by an overwhelming redundancy.”
The effects of chemical necessity would do nothing but REDUCE the ability to transmit information or express novelty.
No information is generated by the occurrence of events for which there are no possible alternatives.
To the degree that chemical predestination exists, to that degree is the information carrying ability of the system reduced by redundancy. In fact it is for no other reason that DNA is NOT chemically predestined. It is only because it is NOT chemically predestined that the DNA molecule is able to store and transmit huge, huge unimaginably huge amounts of information.
It is this physical indeterminacy of the sequence that produces the improbability of occurrence of any particular sequence and thereby enable it to have a meaning - a meaning that has a mathematically determinate information content equal to the numerical improbability of the arrangement.
I ’m defining information between Ginx and I as, “The communication or reception of knowledge or intelligence.” And I`m defining information found in biological organisms as , “the attribute inherent in, and communicated by alternative sequences or arrangements of something that produces specific effects.” Both definitions are from Webster’s English Dictionary.
Information as it is defined in the second definition does not require a conscious recipient of a message; because it is referring to a sequence of characters that produces a specific effect.
Information as it is defined in the first definition means that the only thing preceding our information exchanges were our thoughts which in turn found their origin in our intelligence, our intellect, our mind.
The dull of mind and slow of thought say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”
I say, “I’m defining information between Ginx and I as, “The communication or reception of knowledge or intelligence.” And I`m defining information found in biological organisms as , “the attribute inherent in, and communicated by alternative sequences or arrangements of something that produces specific effects.” Both definitions are from Webster’s English Dictionary.
Atheists say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”
I say, “Information as it is defined in the second definition does not require a conscious recipient of a message; because it is referring to a sequence of characters that produces a specific effect.
Information as it is defined in the first definition means that the only thing preceding our information exchanges were our thoughts which in turn found their origin in our intelligence, our intellect, our mind.
Atheists say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”
I say:
01010111011010000011001011011100010000001101001011
01110001000000111010001101000011001010010000001000
00110110111011101010111001000111001101100101001000
00011011110110011000100000011010000111010101101101
011000010110111000100000011001010111011001100101
011011100111010001110011001000000110100101110100
Know what that says in the American Standard Code for Information Interchange, i.e., Binary Code?
ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGG
CCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCC
GCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCG
CCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAG
GCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC
How about this code? Do you think it took intelligent thought to construct this information in a manner that would allow for life to begin to exist? This is part of the sequence of genetic assembly instructions for constructing an RNA polymerase. This “machine code” is critical for information processing in a living cell. Without it being exactly as is - no working cell.
Watson and Crick, “Molecular Biology of the Gene,” 1:704
Humans of course are used to information.
We create information via our thoughts.
We pass on that information to others, and
We take in information that was created by other people’s thoughts.
We do this all day long.
“The technology of information theory and coding theory has been in place in biology for at least 3.85 billion years.”
“River out of Eden”, 17
As even Richard Dawkins says, “The machine code of the genes is uncannily computer-like.
“DNA is like a computer program but far, far more advanced than any software ever created.”
All of human experience confirms that information comes from thoughts and thoughts come from intelligence.
I show atheists that DNA forms part of a communication channel that can be analysed using information theory.
I show atheists that DNA molecules are highly and quantifiably complex.
I show atheists that the arrangement of bases in DNA and amino acids in proteins carry not just complexity but SPECIFIED complexity.
I show atheists that the information in DNA contains alternative sequences or arrangements that produce a specific effect.
I show atheists that DNA displays a functional specificity that goes WAY beyond the mathematical formalism of information theory.
Whether atheists know it or not (not) this specified complexity is found no where else in nature. Only in DNA, RNA and proteins do we find this information in a specified complex formulation.
Information scientist Hubert Yockey, “The genetic code is constructed to confront and solve the problems of communication and recording by the same principles found in modern communication and computer codes.”
DNA is amazingly complex information. But information is useless if there is no way to retrieve, process, translate and use that information for the PURPOSE intended.
Information is an entity in and of itself? Information is not a by-product, or some sort of residue from chemical reactions.
Information is as real as matter and energy. We own it, buy it, sell it, store it, transmit it, encode it and decode it.
Information comes from a thought that is based in an intelligent mind. The intelligent mind forms / invents a code, be it binary code, or letters in an alphabet, or base chemicals, A,C,G,T and the intelligent mind uses that code to convey the message / instructions to the intended recipient.
This - I love you. I'll meet you after work. - is specified complexity.
Not only does it use parts of a very complex code. It uses the complex code in a formulated and specified manner to convey a message or instructions.
Our cells don’t just contain a place to store vast amounts of information. They contain a code, a specified code (information) for translating that code AND they contain a means, a processing system which allows the construction of proteins.
The main question facing scientists today when trying to explain the origin of first life is: “How did the sequence-specific digital information necessary to building the first cell arise?”
Kuppers, “Information and the Origin of Life,” 170-172.
The reduction of uncertainty takes place with the transmission of information. The more improbable the event the more information that is conveyed.
If forces of potential energy determined the arrangement of the bases, the code-like character of the molecule would be effaced by an overwhelming redundancy.”
The effects of chemical necessity would do nothing but REDUCE the ability to transmit information or express novelty.
No information is generated by the occurrence of events for which there are no possible alternatives.
To the degree that chemical predestination exists, to that degree is the information carrying ability of the system reduced by redundancy. In fact it is for no other reason that DNA is NOT chemically predestined. It is only because it is NOT chemically predestined that the DNA molecule is able to store and transmit huge, huge unimaginably huge amounts of information.
It is this physical indeterminacy of the sequence that produces the improbability of occurrence of any particular sequence and thereby enable it to have a meaning - a meaning that has a mathematically determinate information content equal to the numerical improbability of the arrangement.
I ’m defining information between Ginx and I as, “The communication or reception of knowledge or intelligence.” And I`m defining information found in biological organisms as , “the attribute inherent in, and communicated by alternative sequences or arrangements of something that produces specific effects.” Both definitions are from Webster’s English Dictionary.
Information as it is defined in the second definition does not require a conscious recipient of a message; because it is referring to a sequence of characters that produces a specific effect.
Information as it is defined in the first definition means that the only thing preceding our information exchanges were our thoughts which in turn found their origin in our intelligence, our intellect, our mind.
The dull of mind and slow of thought say, “You needed to get your definition of information straight to stop you making huge errors of equivocation.”
Nature Invents?"
"Nature is just far more inventive in making planets than we were imagining,"
Harvard professor of astronomy - David Charbonneau,
I wonder what kind of comments it would have generated if I had said something that inaccurate from an evolutionary point of view.
Harvard professor of astronomy - David Charbonneau,
I wonder what kind of comments it would have generated if I had said something that inaccurate from an evolutionary point of view.
So, Correct Me!
I seem to have semi or perhaps full blown atheist experts (someone who knows more than I do) lurking at this blog.
. One is an expert in information theory - Gorth
. The other is an expert in biology, chemistry, physics and so on - Ginx.
. Hugo also shows a fair potential in recognising mistakes in what I’ve said. In fact, this has become so easy for him that he’s taken to laughing at me. He’s LAUGHING at me I tell you! :-)
While most people won’t believe this, I don’t want to hold to beliefs that are wrong. So:
Gorth - Please indicate which of the following statements are correct or incorrect, AND if incorrect, please set me on the right path.
Ginx, if you would be so kind, I’m asking you to do the same below.
Hugo, you can pop in wherever you feel a giggle coming on.
I know, that if I’m wrong on EVERYTHING, then this becomes a lot of work for you guys. But I would like to know, if I’m wrong, where I’m wrong and why. So, having said that:
Gorth:
. The reduction of uncertainty takes place with the transmission of information.
. The more improbable the event the more information that is conveyed.
Correct? Incorrect? If incorrect, how, why, where etc.
===================
. No information is generated by the occurrence of events for which there are no possible alternatives.
Correct? Incorrect? If incorrect, how, why, where etc.
================
. Information Content is not just information-carrying capacity.
. Specified Information is not just Shannon information, and
. Specified complexity is not just complexity
Correct? Incorrect? If incorrect, how, why, where etc.
============
. Biological information, such as we find in DNA and proteins, is made of two features:
- Complexity, and
- Functional specificity.
Correct? Incorrect? If incorrect, how, why, where etc.
Ginx, with your expertise in biology, you could maybe give Gorth a hand on this one.
============
If forces of potential energy determined the arrangement of the bases, the code-like character of the molecule would be effaced by an overwhelming redundancy.
Correct? Incorrect? If incorrect, how, why, where etc.
==================
. A “causal difference” is an explanation that is measurably and quantifiably different than explanations that do not meet the criteria of answering the question being studied. A causal difference is an explanation that stands out because it explains what is being studied.
Correct? Incorrect? If incorrect, how, why, where etc.
=============
. Laws of nature (or biochemistry), which denote regular patterns, produce the opposite of formulated information.
Correct? Incorrect? If incorrect, how, why, where etc.
================
Again, I know it’s a lot to ask, but, If I’m wrong, I need to be corrected - yes? Thanks Gorth.
----------------------
Ginx: Now to your areas of expertise.
. There are no chemical bonds linking the nucleotide bases along the message bearing axis of the DNA molecule.
Correct? Incorrect? If incorrect, how, why, where etc.
===========
. The same kind of chemical bonds are responsible for linking the different nucleotide bases to the backbone of the molecule.
Correct? Incorrect? If incorrect, how, why, where etc.
==============
. Any nucleotide base can hook up to the backbone of the DNA molecule at any one site just as easily as it can hook up to any other site.
Correct? Incorrect? If incorrect, how, why, where etc.
. One is an expert in information theory - Gorth
. The other is an expert in biology, chemistry, physics and so on - Ginx.
. Hugo also shows a fair potential in recognising mistakes in what I’ve said. In fact, this has become so easy for him that he’s taken to laughing at me. He’s LAUGHING at me I tell you! :-)
While most people won’t believe this, I don’t want to hold to beliefs that are wrong. So:
Gorth - Please indicate which of the following statements are correct or incorrect, AND if incorrect, please set me on the right path.
Ginx, if you would be so kind, I’m asking you to do the same below.
Hugo, you can pop in wherever you feel a giggle coming on.
I know, that if I’m wrong on EVERYTHING, then this becomes a lot of work for you guys. But I would like to know, if I’m wrong, where I’m wrong and why. So, having said that:
Gorth:
. The reduction of uncertainty takes place with the transmission of information.
. The more improbable the event the more information that is conveyed.
Correct? Incorrect? If incorrect, how, why, where etc.
===================
. No information is generated by the occurrence of events for which there are no possible alternatives.
Correct? Incorrect? If incorrect, how, why, where etc.
================
. Information Content is not just information-carrying capacity.
. Specified Information is not just Shannon information, and
. Specified complexity is not just complexity
Correct? Incorrect? If incorrect, how, why, where etc.
============
. Biological information, such as we find in DNA and proteins, is made of two features:
- Complexity, and
- Functional specificity.
Correct? Incorrect? If incorrect, how, why, where etc.
Ginx, with your expertise in biology, you could maybe give Gorth a hand on this one.
============
If forces of potential energy determined the arrangement of the bases, the code-like character of the molecule would be effaced by an overwhelming redundancy.
Correct? Incorrect? If incorrect, how, why, where etc.
==================
. A “causal difference” is an explanation that is measurably and quantifiably different than explanations that do not meet the criteria of answering the question being studied. A causal difference is an explanation that stands out because it explains what is being studied.
Correct? Incorrect? If incorrect, how, why, where etc.
=============
. Laws of nature (or biochemistry), which denote regular patterns, produce the opposite of formulated information.
Correct? Incorrect? If incorrect, how, why, where etc.
================
Again, I know it’s a lot to ask, but, If I’m wrong, I need to be corrected - yes? Thanks Gorth.
----------------------
Ginx: Now to your areas of expertise.
. There are no chemical bonds linking the nucleotide bases along the message bearing axis of the DNA molecule.
Correct? Incorrect? If incorrect, how, why, where etc.
===========
. The same kind of chemical bonds are responsible for linking the different nucleotide bases to the backbone of the molecule.
Correct? Incorrect? If incorrect, how, why, where etc.
==============
. Any nucleotide base can hook up to the backbone of the DNA molecule at any one site just as easily as it can hook up to any other site.
Correct? Incorrect? If incorrect, how, why, where etc.
Subscribe to:
Posts (Atom)